Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326469301:

Variant ID: vg0326469301 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 26469301
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TATCGCACAAGTTTAAAATGACTTGAACTTGAAATCAGATGGAGAACGCTATATAGTACATCTACATCAGGGGTTAATTAATATATACTACCTTCGTTTC[A/T]
GGTTAAAAGACTTTATAACACTACTCACATTCATATATATATTAATGAATCTAGTCACACATATATATCTAAATTCATTAACATATATATATGAATGTGG

Reverse complement sequence

CCACATTCATATATATATGTTAATGAATTTAGATATATATGTGTGACTAGATTCATTAATATATATATGAATGTGAGTAGTGTTATAAAGTCTTTTAACC[T/A]
GAAACGAAGGTAGTATATATTAATTAACCCCTGATGTAGATGTACTATATAGCGTTCTCCATCTGATTTCAAGTTCAAGTCATTTTAAACTTGTGCGATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	26.30%	0.15%	0.19%	NA
All Indica	2759	55.60%	43.80%	0.25%	0.33%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	78.80%	20.70%	0.17%	0.34%	NA
Indica II	465	14.40%	84.90%	0.43%	0.22%	NA
Indica III	913	61.70%	37.90%	0.22%	0.22%	NA
Indica Intermediate	786	55.50%	43.80%	0.25%	0.51%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0326469301	A -> T	LOC_Os03g46780.1	upstream_gene_variant ; 4929.0bp to feature; MODIFIER	silent_mutation	Average:42.484; most accessible tissue: Callus, score: 75.753	N	N	N	N
vg0326469301	A -> T	LOC_Os03g46790.1	downstream_gene_variant ; 2116.0bp to feature; MODIFIER	silent_mutation	Average:42.484; most accessible tissue: Callus, score: 75.753	N	N	N	N
vg0326469301	A -> T	LOC_Os03g46800.1	downstream_gene_variant ; 2473.0bp to feature; MODIFIER	silent_mutation	Average:42.484; most accessible tissue: Callus, score: 75.753	N	N	N	N
vg0326469301	A -> T	LOC_Os03g46790-LOC_Os03g46800	intergenic_region ; MODIFIER	silent_mutation	Average:42.484; most accessible tissue: Callus, score: 75.753	N	N	N	N
vg0326469301	A -> DEL	N	N	silent_mutation	Average:42.484; most accessible tissue: Callus, score: 75.753	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0326469301	NA	3.55E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	3.00E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	1.46E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	2.30E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	1.66E-07	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	6.00E-12	mr1557	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	5.51E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301	NA	7.15E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251