Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325923493:

Variant ID: vg0325923493 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25923493
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGCACGCAGTCCGACCGGAACAGTTACATGTGATGAAAAAAGTTGAAAGTTTAAATCTAAACACAGTCATAGAATTGTACCCCAATTAATTAACATTATT[G/A]
GCACAGATAAAACATGAACAAGCCCACCGTGTACGTAGATCAGTACTACGTCGTCGGAGCGATCAATTTCGTGCATGGCCGAAAGGACGACGGCCGGCAT

Reverse complement sequence

ATGCCGGCCGTCGTCCTTTCGGCCATGCACGAAATTGATCGCTCCGACGACGTAGTACTGATCTACGTACACGGTGGGCTTGTTCATGTTTTATCTGTGC[C/T]
AATAATGTTAATTAATTGGGGTACAATTCTATGACTGTGTTTAGATTTAAACTTTCAACTTTTTTCATCACATGTAACTGTTCCGGTCGGACTGCGTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 44.90% 2.96% 0.00% NA
All Indica  2759 27.50% 69.30% 3.12% 0.00% NA
All Japonica  1512 85.10% 11.90% 2.98% 0.00% NA
Aus  269 98.10% 1.10% 0.74% 0.00% NA
Indica I  595 41.80% 51.10% 7.06% 0.00% NA
Indica II  465 15.70% 82.60% 1.72% 0.00% NA
Indica III  913 15.60% 84.20% 0.22% 0.00% NA
Indica Intermediate  786 37.70% 58.00% 4.33% 0.00% NA
Temperate Japonica  767 95.40% 0.90% 3.65% 0.00% NA
Tropical Japonica  504 67.50% 30.20% 2.38% 0.00% NA
Japonica Intermediate  241 89.20% 8.70% 2.07% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 26.70% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325923493 G -> A LOC_Os03g45890.1 downstream_gene_variant ; 641.0bp to feature; MODIFIER silent_mutation Average:86.709; most accessible tissue: Callus, score: 97.715 N N N N
vg0325923493 G -> A LOC_Os03g45890-LOC_Os03g45900 intergenic_region ; MODIFIER silent_mutation Average:86.709; most accessible tissue: Callus, score: 97.715 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0325923493 G A 0.09 0.02 0.02 0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325923493 NA 6.39E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0325923493 NA 8.78E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325923493 1.73E-06 1.73E-06 mr1945 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325923493 NA 1.66E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325923493 NA 1.21E-07 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251