Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324765360:

Variant ID: vg0324765360 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24765360
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATTCGTTTTATTCAAAATTTTTGTGCAAATATGAAAATACTTATGTCATGCTTAAAGAACATTTGATGACGAATCAAGTCACAATGAAATAAATGATA[G/T]
CTACATAAATTTTTTTAATAAGACGAATGGTCAAACGTTGGACAAAAAGGCAACGGCGTCATACATTAAAATATGGAGGTAGTAAGTAACAAACATGATG

Reverse complement sequence

CATCATGTTTGTTACTTACTACCTCCATATTTTAATGTATGACGCCGTTGCCTTTTTGTCCAACGTTTGACCATTCGTCTTATTAAAAAAATTTATGTAG[C/A]
TATCATTTATTTCATTGTGACTTGATTCGTCATCAAATGTTCTTTAAGCATGACATAAGTATTTTCATATTTGCACAAAAATTTTGAATAAAACGAATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	13.80%	2.16%	7.66%	NA
All Indica	2759	89.40%	3.80%	1.09%	5.73%	NA
All Japonica	1512	64.00%	33.00%	2.91%	0.07%	NA
Aus	269	18.60%	2.60%	8.92%	69.89%	NA
Indica I	595	97.00%	1.30%	1.18%	0.50%	NA
Indica II	465	97.40%	0.40%	0.22%	1.94%	NA
Indica III	913	84.10%	2.40%	1.20%	12.27%	NA
Indica Intermediate	786	85.00%	9.30%	1.40%	4.33%	NA
Temperate Japonica	767	74.30%	22.30%	3.39%	0.00%	NA
Tropical Japonica	504	43.70%	53.40%	2.78%	0.20%	NA
Japonica Intermediate	241	73.90%	24.50%	1.66%	0.00%	NA
VI/Aromatic	96	62.50%	29.20%	0.00%	8.33%	NA
Intermediate	90	73.30%	14.40%	4.44%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324765360	G -> T	LOC_Os03g44050.1	upstream_gene_variant ; 1865.0bp to feature; MODIFIER	silent_mutation	Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0324765360	G -> T	LOC_Os03g44070.1	upstream_gene_variant ; 2987.0bp to feature; MODIFIER	silent_mutation	Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0324765360	G -> T	LOC_Os03g44050-LOC_Os03g44070	intergenic_region ; MODIFIER	silent_mutation	Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0324765360	G -> DEL	N	N	silent_mutation	Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324765360	NA	5.18E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	NA	7.85E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	5.08E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	1.24E-06	9.93E-07	mr1586	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	NA	2.16E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	5.26E-06	1.42E-06	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	NA	2.63E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	NA	7.03E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324765360	NA	6.10E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251