Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324683717:

Variant ID: vg0324683717 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24683717
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGGCCGAGATGGGAGGAGAAAGGGGAGGAGAGGGAGGAGGAGAGGGAGATGGATCTGAGGAGAGGAGAGGCCGGTTGTTGTTGAGGAGATTGAGGCC[A/G]
GTTGTGGAGGAGAGGATAGGGAATAGGAATTATATACTACGCGTGATTTTAGTCCCAACCGAGATCTTTACTCCCGGTTGGTAATACCAATCAGGACTAA

Reverse complement sequence

TTAGTCCTGATTGGTATTACCAACCGGGAGTAAAGATCTCGGTTGGGACTAAAATCACGCGTAGTATATAATTCCTATTCCCTATCCTCTCCTCCACAAC[T/C]
GGCCTCAATCTCCTCAACAACAACCGGCCTCTCCTCTCCTCAGATCCATCTCCCTCTCCTCCTCCCTCTCCTCCCCTTTCTCCTCCCATCTCGGCCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	22.80%	3.55%	0.21%	NA
All Indica	2759	63.40%	30.40%	5.76%	0.36%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	24.50%	74.00%	1.49%	0.00%	NA
Indica I	595	84.50%	2.40%	13.11%	0.00%	NA
Indica II	465	22.80%	71.80%	4.73%	0.65%	NA
Indica III	913	70.20%	28.80%	0.77%	0.22%	NA
Indica Intermediate	786	63.60%	29.10%	6.62%	0.64%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	66.70%	27.80%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324683717	A -> DEL	N	N	silent_mutation	Average:69.383; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0324683717	A -> G	LOC_Os03g43960.1	downstream_gene_variant ; 2317.0bp to feature; MODIFIER	silent_mutation	Average:69.383; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0324683717	A -> G	LOC_Os03g43950-LOC_Os03g43960	intergenic_region ; MODIFIER	silent_mutation	Average:69.383; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324683717	NA	6.84E-12	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324683717	NA	8.80E-10	mr1188	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324683717	NA	3.06E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324683717	NA	1.53E-08	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324683717	NA	7.47E-07	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324683717	NA	1.81E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324683717	NA	5.84E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251