Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324613201:

Variant ID: vg0324613201 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24613201
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGCAAATCGTATGAACTATTGTTTATGCTCTTAGGAGTTGAGGTCAAATACTAAGATTCCACGTAAAAATACGAATTAAAATGCTGTAGTTCCAATT[T/C]
TTTCATCCAGCAACCAATTTTAAATACCAAACCGGCTTTGTATAAAAAGTTCAGGATCAAATTCGAAGCCTTTTTATCGGTCTATAAACCGTTGTTCATC

Reverse complement sequence

GATGAACAACGGTTTATAGACCGATAAAAAGGCTTCGAATTTGATCCTGAACTTTTTATACAAAGCCGGTTTGGTATTTAAAATTGGTTGCTGGATGAAA[A/G]
AATTGGAACTACAGCATTTTAATTCGTATTTTTACGTGGAATCTTAGTATTTGACCTCAACTCCTAAGAGCATAAACAATAGTTCATACGATTTGCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.60%	41.20%	0.13%	0.00%	NA
All Indica	2759	88.70%	11.10%	0.18%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	85.70%	14.10%	0.17%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	91.50%	8.50%	0.00%	0.00%	NA
Indica Intermediate	786	82.80%	16.70%	0.51%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324613201	T -> C	LOC_Os03g43870.1	upstream_gene_variant ; 3231.0bp to feature; MODIFIER	silent_mutation	Average:35.226; most accessible tissue: Callus, score: 76.623	N	N	N	N
vg0324613201	T -> C	LOC_Os03g43880.1	downstream_gene_variant ; 3121.0bp to feature; MODIFIER	silent_mutation	Average:35.226; most accessible tissue: Callus, score: 76.623	N	N	N	N
vg0324613201	T -> C	LOC_Os03g43870-LOC_Os03g43880	intergenic_region ; MODIFIER	silent_mutation	Average:35.226; most accessible tissue: Callus, score: 76.623	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324613201	NA	3.73E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	2.15E-10	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	2.15E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	7.55E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	8.32E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	2.39E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	2.11E-27	mr1386_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	8.41E-07	mr1386_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	9.07E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	3.17E-06	mr1617_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201	NA	9.44E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251