Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324379515:

Variant ID: vg0324379515 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24379515
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAAGGAAAGTTTCAAAGAGGTTTTACCTCATATTAGAATTCCTCCAAAACTTGCATGGCATTAGGCAATCCATAGGAATTTCATAGTATTCCATAAGA[T/G]
CCATTCCTTTGATTCAAAAGGCTATATAGGAAAAATTCCTATAGGAATGAAATCCTCTAAAATTCCTATAAATTTCCTTTGAATCAAAGGGGGCCTTACT

Reverse complement sequence

AGTAAGGCCCCCTTTGATTCAAAGGAAATTTATAGGAATTTTAGAGGATTTCATTCCTATAGGAATTTTTCCTATATAGCCTTTTGAATCAAAGGAATGG[A/C]
TCTTATGGAATACTATGAAATTCCTATGGATTGCCTAATGCCATGCAAGTTTTGGAGGAATTCTAATATGAGGTAAAACCTCTTTGAAACTTTCCTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.70%	0.04%	0.00%	NA
All Indica	2759	98.10%	1.80%	0.04%	0.00%	NA
All Japonica	1512	1.90%	98.10%	0.00%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.17%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	4.20%	0.00%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	4.60%	95.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324379515	T -> G	LOC_Os03g43610.1	upstream_gene_variant ; 3430.0bp to feature; MODIFIER	silent_mutation	Average:27.216; most accessible tissue: Callus, score: 53.336	N	N	N	N
vg0324379515	T -> G	LOC_Os03g43610-LOC_Os03g43620	intergenic_region ; MODIFIER	silent_mutation	Average:27.216; most accessible tissue: Callus, score: 53.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324379515	NA	6.90E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	NA	5.04E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	NA	5.04E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	NA	6.09E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	2.30E-08	1.88E-40	mr1719	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	1.28E-09	1.05E-08	mr1719	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	NA	1.85E-07	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324379515	3.22E-06	3.22E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251