Search for Variation information by Variation ID:
Detailed information for vg0324374395:
| Variant ID: vg0324374395 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24374395 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CCCTCAACGGAGTATTCCTGTCTCTTGTGTTTGAGTGCAGTACCGAAACTTCTCCATGATGGAGGTAGTTTCGCAATAATGCACCCGGCCACAAATTTGT[T/C]
GAGTAAGACACACTTAAGGAGTTCGAGTTCCTTAGCCATGGTTTGTATCTCATGAGCCTGTTTGACTACAGAACGGTTGTCAGCCATCTTGTAGTCATGA
Reverse complement sequence
TCATGACTACAAGATGGCTGACAACCGTTCTGTAGTCAAACAGGCTCATGAGATACAAACCATGGCTAAGGAACTCGAACTCCTTAAGTGTGTCTTACTC[A/G]
ACAAATTTGTGGCCGGGTGCATTATTGCGAAACTACCTCCATCATGGAGAAGTTTCGGTACTGCACTCAAACACAAGAGACAGGAATACTCCGTTGAGGG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 35.80% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 2.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.70% | 5.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324374395 | T -> C | LOC_Os03g43610.1 | missense_variant ; p.Asn170Asp; MODERATE | nonsynonymous_codon | Average:26.844; most accessible tissue: Zhenshan97 flower, score: 36.732 | possibly damaging  |
-1.641 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324374395 | NA | 1.05E-10 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324374395 | NA | 6.25E-77 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324374395 | NA | 6.54E-114 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324374395 | 9.14E-07 | NA | mr1866 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324374395 | NA | 5.98E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324374395 | NA | 6.14E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |