Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324094127:

Variant ID: vg0324094127 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24094127
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAACATAAAGGGCGGATTTAACATGTGAATAAAGCATATAAGATAAATGTAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATGCTACCCTAATCGG[C/T,A]
AACCAAAAGCAGGCTAGAGATTGTGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATGAAAAGAAAAACAATATCTAGACA

Reverse complement sequence

TGTCTAGATATTGTTTTTCTTTTCATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCACAATCTCTAGCCTGCTTTTGGTT[G/A,T]
CCGATTAGGGTAGCATCGGGGTTTCAGCCGATCTTACCTGATTTAACTACATTTATCTTATATGCTTTATTCACATGTTAAATCCGCCCTTTATGTTAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.80%	0.50%	1.10%	0.57%	A: 0.04%
All Indica	2759	96.40%	0.80%	1.85%	0.87%	A: 0.07%
All Japonica	1512	99.90%	0.00%	0.00%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	0.50%	0.84%	0.34%	NA
Indica II	465	95.90%	1.70%	1.94%	0.00%	A: 0.43%
Indica III	913	94.50%	0.70%	3.40%	1.42%	NA
Indica Intermediate	786	97.50%	0.60%	0.76%	1.15%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324094127	C -> T	LOC_Os03g43210.1	upstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> T	LOC_Os03g43200.1	downstream_gene_variant ; 611.0bp to feature; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> T	LOC_Os03g43220.1	downstream_gene_variant ; 4645.0bp to feature; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> T	LOC_Os03g43200-LOC_Os03g43210	intergenic_region ; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> A	LOC_Os03g43210.1	upstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> A	LOC_Os03g43200.1	downstream_gene_variant ; 611.0bp to feature; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> A	LOC_Os03g43220.1	downstream_gene_variant ; 4645.0bp to feature; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> A	LOC_Os03g43200-LOC_Os03g43210	intergenic_region ; MODIFIER	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0324094127	C -> DEL	N	N	silent_mutation	Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324094127	NA	4.25E-06	mr1428	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127	NA	3.72E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127	3.55E-07	3.55E-07	mr1462	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127	2.11E-06	2.11E-06	mr1462	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127	NA	9.46E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251