Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324076908:

Variant ID: vg0324076908 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24076908
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTGTTGATTTCGTTCATTTGCTTTAGTTTCTGACGTTCCGGAGGAGAGCGTTTACATTGAGGAAGGTTCAGAGGTGTTTGAAGAATCTCAAGGCAA[T/G]
TCACACAGATTCCAAACAACCCTTTGAGCATGTTGGACCCGTTTAAAGCTAATGTTTTATTTCAACTTATGCATTATTTTCGAATGTCATCGGGTGGTGA

Reverse complement sequence

TCACCACCCGATGACATTCGAAAATAATGCATAAGTTGAAATAAAACATTAGCTTTAAACGGGTCCAACATGCTCAAAGGGTTGTTTGGAATCTGTGTGA[A/C]
TTGCCTTGAGATTCTTCAAACACCTCTGAACCTTCCTCAATGTAAACGCTCTCCTCCGGAACGTCAGAAACTAAAGCAAATGAACGAAATCAACAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	2.30%	1.33%	56.26%	NA
All Indica	2759	5.80%	0.40%	2.17%	91.70%	NA
All Japonica	1512	99.20%	0.00%	0.00%	0.79%	NA
Aus	269	42.40%	36.10%	0.37%	21.19%	NA
Indica I	595	7.20%	0.20%	1.34%	91.26%	NA
Indica II	465	2.60%	0.90%	1.94%	94.62%	NA
Indica III	913	3.60%	0.00%	2.08%	94.30%	NA
Indica Intermediate	786	9.00%	0.60%	3.05%	87.28%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	78.10%	0.00%	1.04%	20.83%	NA
Intermediate	90	51.10%	3.30%	1.11%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324076908	T -> DEL	N	N	silent_mutation	Average:7.628; most accessible tissue: Callus, score: 17.552	N	N	N	N
vg0324076908	T -> G	LOC_Os03g43150.1	upstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:7.628; most accessible tissue: Callus, score: 17.552	N	N	N	N
vg0324076908	T -> G	LOC_Os03g43160.1	upstream_gene_variant ; 2382.0bp to feature; MODIFIER	silent_mutation	Average:7.628; most accessible tissue: Callus, score: 17.552	N	N	N	N
vg0324076908	T -> G	LOC_Os03g43150-LOC_Os03g43160	intergenic_region ; MODIFIER	silent_mutation	Average:7.628; most accessible tissue: Callus, score: 17.552	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324076908	NA	6.31E-06	mr1434	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908	NA	8.75E-11	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908	1.60E-07	NA	mr1681	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908	3.91E-10	3.91E-10	mr1681	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908	NA	2.11E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908	1.56E-06	1.56E-06	mr1779	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908	NA	1.74E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251