| Variant ID: vg0323778716 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23778716 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATGCTTGTCTGTCATGTTTGGATGATATATATATATGCATACATGTTAGTTGCCTGCCTACTGTATCAGTGCAGTACAATCGTGAATGTGTAAAACCCT[G/A]
TACAATGAGCTACATAATCTTACCGTGTATTCATCTCAAATGTCACCGTGTGCTAAATCTCACGGGAAGAATTTAAACATTCCCGGGCCACTAAAAACTC
GAGTTTTTAGTGGCCCGGGAATGTTTAAATTCTTCCCGTGAGATTTAGCACACGGTGACATTTGAGATGAATACACGGTAAGATTATGTAGCTCATTGTA[C/T]
AGGGTTTTACACATTCACGATTGTACTGCACTGATACAGTAGGCAGGCAACTAACATGTATGCATATATATATATCATCCAAACATGACAGACAAGCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 0.30% | 3.43% | 59.20% | NA |
| All Indica | 2759 | 3.60% | 0.50% | 5.84% | 90.11% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.07% | 0.60% | NA |
| Aus | 269 | 4.10% | 0.00% | 0.00% | 95.91% | NA |
| Indica I | 595 | 2.50% | 0.20% | 4.20% | 93.11% | NA |
| Indica II | 465 | 3.00% | 0.00% | 6.24% | 90.75% | NA |
| Indica III | 913 | 3.00% | 0.00% | 5.59% | 91.46% | NA |
| Indica Intermediate | 786 | 5.30% | 1.70% | 7.12% | 85.88% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 56.70% | 0.00% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323778716 | G -> A | LOC_Os03g42710.1 | upstream_gene_variant ; 2395.0bp to feature; MODIFIER | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 18.62 | N | N | N | N |
| vg0323778716 | G -> A | LOC_Os03g42690.1 | downstream_gene_variant ; 532.0bp to feature; MODIFIER | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 18.62 | N | N | N | N |
| vg0323778716 | G -> A | LOC_Os03g42700.1 | downstream_gene_variant ; 1459.0bp to feature; MODIFIER | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 18.62 | N | N | N | N |
| vg0323778716 | G -> A | LOC_Os03g42690-LOC_Os03g42700 | intergenic_region ; MODIFIER | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 18.62 | N | N | N | N |
| vg0323778716 | G -> DEL | N | N | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 18.62 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323778716 | NA | 6.64E-09 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0323778716 | NA | 7.16E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | NA | 7.27E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | NA | 4.59E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | NA | 2.98E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | NA | 1.13E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | NA | 3.15E-09 | mr1254 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | 2.00E-06 | 2.45E-06 | mr1286 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | 7.54E-06 | 1.19E-06 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323778716 | NA | 5.31E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/