Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322556933:

Variant ID: vg0322556933 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22556933
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGTCGAAGAAGTGCAAGCCCTCCGCAAGGAGTTCGACGCTTAGCAAGCAAGCAACCATCAGCAGCCTGTCCGAAAGAAGGTCCGAAAAGACCTCTACTG[T/C]
GCCTTCCACGGACGCTCTTCGCACACCACGGAGCAATGCCGAAATATTTGGCAACGTGGCAACGCGCAAGATCCAAGGACGCAGCAGGGAGCAGCGGCCG

Reverse complement sequence

CGGCCGCTGCTCCCTGCTGCGTCCTTGGATCTTGCGCGTTGCCACGTTGCCAAATATTTCGGCATTGCTCCGTGGTGTGCGAAGAGCGTCCGTGGAAGGC[A/G]
CAGTAGAGGTCTTTTCGGACCTTCTTTCGGACAGGCTGCTGATGGTTGCTTGCTTGCTAAGCGTCGAACTCCTTGCGGAGGGCTTGCACTTCTTCGACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	36.70%	0.17%	6.94%	NA
All Indica	2759	84.80%	3.10%	0.25%	11.82%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	53.60%	4.50%	0.84%	41.01%	NA
Indica II	465	93.10%	3.70%	0.00%	3.23%	NA
Indica III	913	99.00%	0.90%	0.00%	0.11%	NA
Indica Intermediate	786	87.00%	4.30%	0.25%	8.40%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	40.00%	57.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322556933	T -> C	LOC_Os03g40570.1	upstream_gene_variant ; 3013.0bp to feature; MODIFIER	silent_mutation	Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg0322556933	T -> C	LOC_Os03g40550.1	downstream_gene_variant ; 4887.0bp to feature; MODIFIER	silent_mutation	Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg0322556933	T -> C	LOC_Os03g40560.1	intron_variant ; MODIFIER	silent_mutation	Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg0322556933	T -> DEL	N	N	silent_mutation	Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322556933	2.09E-06	NA	mr1231	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933	NA	1.51E-07	mr1408	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933	NA	1.34E-06	mr1408	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933	NA	4.86E-09	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933	NA	2.55E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933	NA	5.47E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933	NA	1.72E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251