Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322555893:

Variant ID: vg0322555893 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22555893
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCCAGGTCTGGGGATTCGCCGTGGAGTCAAGGACCGTAGTTCGACTCTATCAATGCTGCTCAGGCGCCAACCGTTCGGCCGCAAGCACCAACACCAGG[C/G,T]
TTCGGAGCAAACCAAGCACCAAACCAGGTCACCATGACATGGTCACAGCCAACTTTCGACCCATTCATGGCGGCACAGCAAGCATCACCAATCGGGGCTG

Reverse complement sequence

CAGCCCCGATTGGTGATGCTTGCTGTGCCGCCATGAATGGGTCGAAAGTTGGCTGTGACCATGTCATGGTGACCTGGTTTGGTGCTTGGTTTGCTCCGAA[G/C,A]
CCTGGTGTTGGTGCTTGCGGCCGAACGGTTGGCGCCTGAGCAGCATTGATAGAGTCGAACTACGGTCCTTGACTCCACGGCGAATCCCCAGACCTGGCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	19.60%	3.17%	1.57%	T: 0.76%
All Indica	2759	58.60%	32.70%	5.15%	2.28%	T: 1.20%
All Japonica	1512	98.70%	0.30%	0.33%	0.66%	NA
Aus	269	98.90%	0.00%	0.00%	0.00%	T: 1.12%
Indica I	595	96.10%	3.20%	0.67%	0.00%	NA
Indica II	465	28.80%	56.30%	9.25%	4.30%	T: 1.29%
Indica III	913	51.30%	38.90%	4.82%	2.74%	T: 2.30%
Indica Intermediate	786	56.50%	34.00%	6.49%	2.29%	T: 0.76%
Temperate Japonica	767	99.10%	0.10%	0.65%	0.13%	NA
Tropical Japonica	504	97.40%	0.80%	0.00%	1.79%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	16.70%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322555893	C -> T	LOC_Os03g40570.1	upstream_gene_variant ; 4053.0bp to feature; MODIFIER	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0322555893	C -> T	LOC_Os03g40550.1	downstream_gene_variant ; 3847.0bp to feature; MODIFIER	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0322555893	C -> T	LOC_Os03g40560.1	intron_variant ; MODIFIER	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0322555893	C -> DEL	N	N	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0322555893	C -> G	LOC_Os03g40570.1	upstream_gene_variant ; 4053.0bp to feature; MODIFIER	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0322555893	C -> G	LOC_Os03g40550.1	downstream_gene_variant ; 3847.0bp to feature; MODIFIER	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0322555893	C -> G	LOC_Os03g40560.1	intron_variant ; MODIFIER	silent_mutation	Average:52.042; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322555893	NA	2.48E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322555893	NA	9.60E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322555893	NA	1.44E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322555893	NA	3.72E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322555893	4.68E-06	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322555893	NA	1.10E-08	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322555893	1.05E-07	NA	mr1632_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322555893	2.84E-06	9.94E-10	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251