| Variant ID: vg0322428586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22428586 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGACGTCCCTAATCATATTAATTCAGTAGCCGTCATCGTTTAGAGTTAGGTTTTGCTTAGATTACTCTGTCAAGAATAGTTTTGCCGCTAGATCGGTTT[G/A]
TGGAACCCCAAATTCGTGTGCTTAATCATTCATATGCAATTTGGTTGCAATCTATCTTGTTCTTGCTTGTGTTCTTCGATTCGCATGCAGGGATTAGCCT
AGGCTAATCCCTGCATGCGAATCGAAGAACACAAGCAAGAACAAGATAGATTGCAACCAAATTGCATATGAATGATTAAGCACACGAATTTGGGGTTCCA[C/T]
AAACCGATCTAGCGGCAAAACTATTCTTGACAGAGTAATCTAAGCAAAACCTAACTCTAAACGATGACGGCTACTGAATTAATATGATTAGGGACGTCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 4.70% | 2.79% | 0.91% | NA |
| All Indica | 2759 | 99.00% | 0.60% | 0.33% | 0.07% | NA |
| All Japonica | 1512 | 93.70% | 0.00% | 3.64% | 2.71% | NA |
| Aus | 269 | 25.30% | 74.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.30% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.80% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 95.40% | 0.00% | 2.98% | 1.59% | NA |
| Japonica Intermediate | 241 | 72.20% | 0.00% | 16.18% | 11.62% | NA |
| VI/Aromatic | 96 | 33.30% | 4.20% | 62.50% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 2.20% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322428586 | G -> A | LOC_Os03g40320.1 | upstream_gene_variant ; 4848.0bp to feature; MODIFIER | silent_mutation | Average:26.999; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0322428586 | G -> A | LOC_Os03g40330.1 | upstream_gene_variant ; 3745.0bp to feature; MODIFIER | silent_mutation | Average:26.999; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0322428586 | G -> A | LOC_Os03g40360.1 | upstream_gene_variant ; 1652.0bp to feature; MODIFIER | silent_mutation | Average:26.999; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0322428586 | G -> A | LOC_Os03g40330-LOC_Os03g40360 | intergenic_region ; MODIFIER | silent_mutation | Average:26.999; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| vg0322428586 | G -> DEL | N | N | silent_mutation | Average:26.999; most accessible tissue: Zhenshan97 flower, score: 33.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322428586 | NA | 4.60E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322428586 | 1.32E-06 | NA | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322428586 | 3.39E-07 | NA | mr1904_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |