Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322179197:

Variant ID: vg0322179197 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22179197
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGACGGGCTGAAAACGGAGGTCGTATGGAGATTCGGCGGCCGTTTGAAGTCAGCAGTGTAGTAGGTGGCCGAATCGGATTCCAGCACTTGGAGGACTT[A/G]
AACTTGATATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCATGGTCACATCAAGAACCTTGCCGGAGCCAGATCATCGGTCAG

Reverse complement sequence

CTGACCGATGATCTGGCTCCGGCAAGGTTCTTGATGTGACCATGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATATCAAGTT[T/C]
AAGTCCTCCAAGTGCTGGAATCCGATTCGGCCACCTACTACACTGCTGACTTCAAACGGCCGCCGAATCTCCATACGACCTCCGTTTTCAGCCCGTCAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.30%	18.10%	8.15%	33.45%	NA
All Indica	2759	17.40%	16.20%	12.21%	54.22%	NA
All Japonica	1512	90.00%	8.30%	0.07%	1.65%	NA
Aus	269	4.80%	72.10%	12.27%	10.78%	NA
Indica I	595	7.40%	48.60%	14.96%	29.08%	NA
Indica II	465	14.80%	4.70%	9.25%	71.18%	NA
Indica III	913	28.10%	1.10%	13.69%	57.06%	NA
Indica Intermediate	786	14.00%	15.90%	10.18%	59.92%	NA
Temperate Japonica	767	97.30%	2.60%	0.00%	0.13%	NA
Tropical Japonica	504	90.70%	4.40%	0.20%	4.76%	NA
Japonica Intermediate	241	65.60%	34.40%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	80.20%	7.29%	9.38%	NA
Intermediate	90	51.10%	16.70%	7.78%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322179197	A -> DEL	N	N	silent_mutation	Average:27.616; most accessible tissue: Callus, score: 77.14	N	N	N	N
vg0322179197	A -> G	LOC_Os03g39890.1	upstream_gene_variant ; 2084.0bp to feature; MODIFIER	silent_mutation	Average:27.616; most accessible tissue: Callus, score: 77.14	N	N	N	N
vg0322179197	A -> G	LOC_Os03g39900.1	upstream_gene_variant ; 58.0bp to feature; MODIFIER	silent_mutation	Average:27.616; most accessible tissue: Callus, score: 77.14	N	N	N	N
vg0322179197	A -> G	LOC_Os03g39880.1	downstream_gene_variant ; 4248.0bp to feature; MODIFIER	silent_mutation	Average:27.616; most accessible tissue: Callus, score: 77.14	N	N	N	N
vg0322179197	A -> G	LOC_Os03g39890-LOC_Os03g39900	intergenic_region ; MODIFIER	silent_mutation	Average:27.616; most accessible tissue: Callus, score: 77.14	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322179197	NA	5.65E-09	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	1.87E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	6.31E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	1.92E-06	NA	mr1612	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	8.78E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	1.31E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	4.11E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	4.11E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	NA	1.38E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322179197	5.71E-06	5.70E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251