Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321961541:

Variant ID: vg0321961541 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21961541
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAATATGCAAACAACAAAAAACAATGAAAAAATGACTAAAGATGGTAGCACCTGCCACGTGACACTACCACTAAAGATGGGCATCTTTAGTGACACTA[T/C]
CACTAAAGATGGGCATCTTTAGTTCCGGCTATTTCAATCAGGACTAAAGATGGGCATCTTTAGTCCCGGATTCGGGGTCCCGGCTATGTACGCGGGATTA

Reverse complement sequence

TAATCCCGCGTACATAGCCGGGACCCCGAATCCGGGACTAAAGATGCCCATCTTTAGTCCTGATTGAAATAGCCGGAACTAAAGATGCCCATCTTTAGTG[A/G]
TAGTGTCACTAAAGATGCCCATCTTTAGTGGTAGTGTCACGTGGCAGGTGCTACCATCTTTAGTCATTTTTTCATTGTTTTTTGTTGTTTGCATATTAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	0.30%	0.25%	17.50%	NA
All Indica	2759	69.90%	0.00%	0.43%	29.68%	NA
All Japonica	1512	99.00%	0.90%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	31.40%	0.00%	1.01%	67.56%	NA
Indica II	465	89.20%	0.00%	0.00%	10.75%	NA
Indica III	913	74.40%	0.00%	0.33%	25.30%	NA
Indica Intermediate	786	82.30%	0.00%	0.38%	17.30%	NA
Temperate Japonica	767	98.40%	1.40%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	0.00%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321961541	T -> C	LOC_Os03g39540.1	upstream_gene_variant ; 1051.0bp to feature; MODIFIER	silent_mutation	Average:10.343; most accessible tissue: Callus, score: 59.883	N	N	N	N
vg0321961541	T -> C	LOC_Os03g39550.1	downstream_gene_variant ; 1674.0bp to feature; MODIFIER	silent_mutation	Average:10.343; most accessible tissue: Callus, score: 59.883	N	N	N	N
vg0321961541	T -> C	LOC_Os03g39540-LOC_Os03g39550	intergenic_region ; MODIFIER	silent_mutation	Average:10.343; most accessible tissue: Callus, score: 59.883	N	N	N	N
vg0321961541	T -> DEL	N	N	silent_mutation	Average:10.343; most accessible tissue: Callus, score: 59.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321961541	NA	5.98E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	5.48E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	9.86E-07	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	4.01E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	6.58E-09	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	5.80E-08	NA	mr1857	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	1.93E-08	5.88E-12	mr1857	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	3.91E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	3.01E-07	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	7.99E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321961541	NA	1.34E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251