Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321772541:

Variant ID: vg0321772541 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21772541
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.03, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTTTAAAGAGATAAAGGAAGAGGGAGAAGAGCAGCGGGCTATAGATCTGTAGCCAGCTGCAGCACGAACTCCAAGACGTAATGTGTGTATGACATGT[G/A]
GGACCATATATTAATAATATAGTAAACAACTATTGTATAAATTAGCTATTACATTGGCTATAAATGATTTGGAGCTGATAGTGGGCTATAATGTTAAACT

Reverse complement sequence

AGTTTAACATTATAGCCCACTATCAGCTCCAAATCATTTATAGCCAATGTAATAGCTAATTTATACAATAGTTGTTTACTATATTATTAATATATGGTCC[C/T]
ACATGTCATACACACATTACGTCTTGGAGTTCGTGCTGCAGCTGGCTACAGATCTATAGCCCGCTGCTCTTCTCCCTCTTCCTTTATCTCTTTAAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	43.70%	0.08%	0.00%	NA
All Indica	2759	91.80%	8.10%	0.11%	0.00%	NA
All Japonica	1512	1.90%	98.10%	0.00%	0.00%	NA
Aus	269	20.10%	79.90%	0.00%	0.00%	NA
Indica I	595	94.60%	5.40%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	91.80%	8.10%	0.11%	0.00%	NA
Indica Intermediate	786	87.30%	12.50%	0.25%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.80%	95.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	41.10%	57.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321772541	G -> A	LOC_Os03g39200.1	upstream_gene_variant ; 3191.0bp to feature; MODIFIER	silent_mutation	Average:60.253; most accessible tissue: Callus, score: 83.938	N	N	N	N
vg0321772541	G -> A	LOC_Os03g39210.1	downstream_gene_variant ; 2790.0bp to feature; MODIFIER	silent_mutation	Average:60.253; most accessible tissue: Callus, score: 83.938	N	N	N	N
vg0321772541	G -> A	LOC_Os03g39200-LOC_Os03g39210	intergenic_region ; MODIFIER	silent_mutation	Average:60.253; most accessible tissue: Callus, score: 83.938	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321772541	NA	1.02E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321772541	8.96E-07	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321772541	NA	4.54E-13	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321772541	3.76E-10	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321772541	8.16E-10	7.74E-22	mr1750_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321772541	1.22E-06	1.26E-08	mr1987_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251