Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320879541:

Variant ID: vg0320879541 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20879541
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGATTATATACGGTATATTGATTTTTAGTCCCAGTTGATAATAACAACCGAGATTAAAGATCAACATAAGCTTTAGTCCCGGTTGTAAACAACAACCG[G/A]
GACTAAAGTTAGCATTTTCAGTCCCGGTTGGTATTACAAATCGGGACTAAAGATCTCTGGGACCTGACAGCCTCTGACACAGGGTGGAACTGGAAGTAAA

Reverse complement sequence

TTTACTTCCAGTTCCACCCTGTGTCAGAGGCTGTCAGGTCCCAGAGATCTTTAGTCCCGATTTGTAATACCAACCGGGACTGAAAATGCTAACTTTAGTC[C/T]
CGGTTGTTGTTTACAACCGGGACTAAAGCTTATGTTGATCTTTAATCTCGGTTGTTATTATCAACTGGGACTAAAAATCAATATACCGTATATAATCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	9.50%	2.54%	0.00%	NA
All Indica	2759	79.80%	15.90%	4.28%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	82.20%	7.60%	10.25%	0.00%	NA
Indica II	465	95.50%	1.30%	3.23%	0.00%	NA
Indica III	913	71.10%	28.50%	0.44%	0.00%	NA
Indica Intermediate	786	78.80%	16.40%	4.83%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320879541	G -> A	LOC_Os03g37640.1	upstream_gene_variant ; 3824.0bp to feature; MODIFIER	silent_mutation	Average:62.344; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0320879541	G -> A	LOC_Os03g37640.2	upstream_gene_variant ; 3824.0bp to feature; MODIFIER	silent_mutation	Average:62.344; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0320879541	G -> A	LOC_Os03g37650.1	downstream_gene_variant ; 2078.0bp to feature; MODIFIER	silent_mutation	Average:62.344; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0320879541	G -> A	LOC_Os03g37640-LOC_Os03g37650	intergenic_region ; MODIFIER	silent_mutation	Average:62.344; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320879541	NA	9.45E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	NA	3.19E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	NA	1.30E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	1.30E-06	7.18E-08	mr1043_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	4.02E-06	4.88E-07	mr1269_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	NA	4.19E-06	mr1502_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	NA	1.63E-06	mr1677_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320879541	3.56E-07	3.56E-07	mr1912_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251