Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319775799:

Variant ID: vg0319775799 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19775799
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCAAAATTTGTTATGCCTCCGTAGCGCACCCCATGAGCAATGGACAAGTCGAACATGCCAATGGTATGGTACTTCAAGGAATAAAAGCGCGAGATTTT[T/G]
ACCGACTGCATCCCTATGCCGGCAAGTGGGTAGAACAACTTCCATCTGTACTCTGGTCCCTGCGCACCACTCCCAATCGAGCTACGGGCCAGTCGCCGTT

Reverse complement sequence

AACGGCGACTGGCCCGTAGCTCGATTGGGAGTGGTGCGCAGGGACCAGAGTACAGATGGAAGTTGTTCTACCCACTTGCCGGCATAGGGATGCAGTCGGT[A/C]
AAAATCTCGCGCTTTTATTCCTTGAAGTACCATACCATTGGCATGTTCGACTTGTCCATTGCTCATGGGGTGCGCTACGGAGGCATAACAAATTTTGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	31.50%	0.70%	0.23%	NA
All Indica	2759	97.70%	1.80%	0.18%	0.33%	NA
All Japonica	1512	12.10%	86.20%	1.59%	0.13%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.20%	0.50%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	98.60%	1.00%	0.11%	0.33%	NA
Indica Intermediate	786	96.40%	2.70%	0.13%	0.76%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	31.90%	65.70%	2.38%	0.00%	NA
Japonica Intermediate	241	7.90%	86.30%	4.98%	0.83%	NA
VI/Aromatic	96	25.00%	74.00%	1.04%	0.00%	NA
Intermediate	90	53.30%	43.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319775799	T -> DEL	N	N	silent_mutation	Average:49.189; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N
vg0319775799	T -> G	LOC_Os03g35700.1	downstream_gene_variant ; 949.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N
vg0319775799	T -> G	LOC_Os03g35710.1	downstream_gene_variant ; 838.0bp to feature; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N
vg0319775799	T -> G	LOC_Os03g35700-LOC_Os03g35710	intergenic_region ; MODIFIER	silent_mutation	Average:49.189; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319775799	NA	1.93E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	9.62E-06	2.08E-09	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	NA	1.14E-12	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	NA	4.32E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	NA	9.33E-09	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	NA	5.80E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	2.73E-06	1.95E-22	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319775799	4.14E-06	2.64E-10	mr1987_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251