Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319282541:

Variant ID: vg0319282541 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19282541
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGGGTATAAATAGACCCCGAGCCCTATGTAACTTTAAGAACACACGTTCAATACAATCTCGGCGCATCGCCACCCTTTTTTGTTTTAGTTTTATTTCGA[T/C]
GAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTGGTGCTTCCATCTT

Reverse complement sequence

AAGATGGAAGCACCAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTC[A/G]
TCGAAATAAAACTAAAACAAAAAAGGGTGGCGATGCGCCGAGATTGTATTGAACGTGTGTTCTTAAAGTTACATAGGGCTCGGGGTCTATTTATACCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	32.70%	2.56%	0.23%	NA
All Indica	2759	89.80%	6.10%	4.13%	0.04%	NA
All Japonica	1512	17.30%	81.90%	0.20%	0.66%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	91.40%	5.40%	3.19%	0.00%	NA
Indica II	465	82.60%	9.50%	7.96%	0.00%	NA
Indica III	913	95.60%	2.00%	2.41%	0.00%	NA
Indica Intermediate	786	86.00%	9.30%	4.58%	0.13%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	38.10%	61.90%	0.00%	0.00%	NA
Japonica Intermediate	241	26.60%	68.50%	0.83%	4.15%	NA
VI/Aromatic	96	26.00%	71.90%	2.08%	0.00%	NA
Intermediate	90	48.90%	48.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319282541	T -> C	LOC_Os03g33730.1	upstream_gene_variant ; 757.0bp to feature; MODIFIER	silent_mutation	Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0319282541	T -> C	LOC_Os03g33740.1	upstream_gene_variant ; 4938.0bp to feature; MODIFIER	silent_mutation	Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0319282541	T -> C	LOC_Os03g33720.1	downstream_gene_variant ; 4232.0bp to feature; MODIFIER	silent_mutation	Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0319282541	T -> C	LOC_Os03g33730-LOC_Os03g33740	intergenic_region ; MODIFIER	silent_mutation	Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0319282541	T -> DEL	N	N	silent_mutation	Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319282541	NA	6.14E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	6.17E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	9.09E-06	9.09E-06	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	1.77E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	1.94E-06	mr1350	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	5.83E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	8.60E-06	mr1607	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	8.35E-07	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	NA	9.92E-09	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541	7.74E-06	1.86E-08	mr1866	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251