Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319079018:

Variant ID: vg0319079018 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19079018
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGGATGCTTAAACTTGTGGGAGGAGGTCTGCCTGGAGACACAAGCGGTTTGACCATGGGTCAGCCGCCGGTCTGACCGGCCGGCAGCCGTCGGTCTGAC[T/C]
GGCCACCATGGGCGGTCTGACCGGCCTGATGCCTTCGGTCTGACCACCCTACTGGCTGCGGTCTGACCACCCCTCCACAGGATGTAGGCAAATTTTTACC

Reverse complement sequence

GGTAAAAATTTGCCTACATCCTGTGGAGGGGTGGTCAGACCGCAGCCAGTAGGGTGGTCAGACCGAAGGCATCAGGCCGGTCAGACCGCCCATGGTGGCC[A/G]
GTCAGACCGACGGCTGCCGGCCGGTCAGACCGGCGGCTGACCCATGGTCAAACCGCTTGTGTCTCCAGGCAGACCTCCTCCCACAAGTTTAAGCATCCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	32.70%	0.63%	13.54%	NA
All Indica	2759	78.60%	3.40%	0.87%	17.07%	NA
All Japonica	1512	2.10%	86.80%	0.40%	10.71%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	92.90%	3.20%	0.17%	3.70%	NA
Indica II	465	74.80%	3.40%	0.65%	21.08%	NA
Indica III	913	69.60%	1.60%	1.64%	27.16%	NA
Indica Intermediate	786	80.50%	5.70%	0.64%	13.10%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	5.00%	66.70%	0.99%	27.38%	NA
Japonica Intermediate	241	1.70%	88.00%	0.41%	9.96%	NA
VI/Aromatic	96	25.00%	72.90%	0.00%	2.08%	NA
Intermediate	90	47.80%	46.70%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319079018	T -> C	LOC_Os03g33370.1	upstream_gene_variant ; 158.0bp to feature; MODIFIER	silent_mutation	Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N
vg0319079018	T -> C	LOC_Os03g33360.1	downstream_gene_variant ; 1859.0bp to feature; MODIFIER	silent_mutation	Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N
vg0319079018	T -> C	LOC_Os03g33360-LOC_Os03g33370	intergenic_region ; MODIFIER	silent_mutation	Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N
vg0319079018	T -> DEL	N	N	silent_mutation	Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319079018	2.29E-06	NA	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	1.08E-06	1.98E-12	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	NA	3.53E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	NA	1.15E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	NA	1.37E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	4.70E-06	1.93E-09	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	4.01E-06	1.27E-13	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	2.48E-06	2.48E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	NA	2.01E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	NA	9.27E-10	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	6.86E-06	1.40E-18	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018	6.96E-07	2.38E-10	mr1987_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251