Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318856031:

Variant ID: vg0318856031 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18856031
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCCACCCATGCGCCGTCGGCCGCACCACCACCACCTTCAGAATCGCAGCGGCAAGGTCATCCTCGGCATCGCCTTCCCTCCATCCCAACCCCTCCACT[G/A]
TCCGTCGTCGTCGTCACCGTTCGTCCTCGACGTCGACGTCCCGTCGGTCGCCCGGCACATCGTCTCGCGGCGCCGCCTCCGTCGTCGGATTCGCAACGGC

Reverse complement sequence

GCCGTTGCGAATCCGACGACGGAGGCGGCGCCGCGAGACGATGTGCCGGGCGACCGACGGGACGTCGACGTCGAGGACGAACGGTGACGACGACGACGGA[C/T]
AGTGGAGGGGTTGGGATGGAGGGAAGGCGATGCCGAGGATGACCTTGCCGCTGCGATTCTGAAGGTGGTGGTGGTGCGGCCGACGGCGCATGGGTGGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 5.20% 1.12% 0.76% NA
All Indica  2759 88.90% 8.60% 1.85% 0.65% NA
All Japonica  1512 98.80% 0.10% 0.00% 1.06% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 0.30% 1.01% 0.67% NA
Indica II  465 67.50% 27.70% 4.30% 0.43% NA
Indica III  913 95.90% 2.10% 1.31% 0.66% NA
Indica Intermediate  786 86.60% 10.90% 1.65% 0.76% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 0.00% 0.00% 6.64% NA
VI/Aromatic  96 95.80% 1.00% 1.04% 2.08% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318856031 G -> A LOC_Os03g32980.1 missense_variant ; p.Cys31Tyr; MODERATE nonsynonymous_codon ; C31Y Average:72.59; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 unknown unknown TOLERATED 1.00
vg0318856031 G -> DEL LOC_Os03g32980.1 N frameshift_variant Average:72.59; most accessible tissue: Zhenshan97 flag leaf, score: 90.298 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0318856031 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318856031 1.15E-06 1.15E-06 mr1313_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318856031 1.36E-07 1.36E-07 mr1473_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318856031 6.29E-08 6.29E-08 mr1630_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318856031 1.04E-07 1.04E-07 mr1848_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251