Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318828127:

Variant ID: vg0318828127 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18828127
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.07, T: 0.07, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGGCGCTCCCTGTGACGTTCGGGAGGCGAGTGAACAGATCGTTCGTCGTGACCCCTGCTCCTGCGATTAGATCCTATGCCGATGATGCTGAGGCTTGG[C/T]
TGATGATAATCATGAGATCGGAGGTGAGGGACTCGGCTACCGGTCGGGGTGCGGGTGCTTGCGGAGTTGGCTAGAACCGAGGCAACGATCATGGTCTTCG

Reverse complement sequence

CGAAGACCATGATCGTTGCCTCGGTTCTAGCCAACTCCGCAAGCACCCGCACCCCGACCGGTAGCCGAGTCCCTCACCTCCGATCTCATGATTATCATCA[G/A]
CCAAGCCTCAGCATCATCGGCATAGGATCTAATCGCAGGAGCAGGGGTCACGACGAACGATCTGTTCACTCGCCTCCCGAACGTCACAGGGAGCGCCGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.80%	29.80%	3.39%	28.02%	NA
All Indica	2759	9.30%	48.10%	4.02%	38.60%	NA
All Japonica	1512	86.90%	0.70%	0.40%	12.04%	NA
Aus	269	51.70%	17.10%	14.13%	17.10%	NA
Indica I	595	7.90%	51.30%	2.18%	38.66%	NA
Indica II	465	8.20%	17.20%	6.45%	68.17%	NA
Indica III	913	9.60%	60.00%	4.05%	26.29%	NA
Indica Intermediate	786	10.60%	50.10%	3.94%	35.37%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	68.80%	1.40%	1.19%	28.57%	NA
Japonica Intermediate	241	84.20%	0.40%	0.00%	15.35%	NA
VI/Aromatic	96	77.10%	3.10%	5.21%	14.58%	NA
Intermediate	90	57.80%	23.30%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318828127	C -> T	LOC_Os03g32920.1	upstream_gene_variant ; 1158.0bp to feature; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 27.069	N	N	N	N
vg0318828127	C -> T	LOC_Os03g32910.1	downstream_gene_variant ; 4546.0bp to feature; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 27.069	N	N	N	N
vg0318828127	C -> T	LOC_Os03g32940.1	downstream_gene_variant ; 4950.0bp to feature; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 27.069	N	N	N	N
vg0318828127	C -> T	LOC_Os03g32930.1	intron_variant ; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 27.069	N	N	N	N
vg0318828127	C -> DEL	N	N	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 27.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318828127	1.81E-06	1.02E-07	mr1214	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	2.26E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	1.72E-07	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	2.06E-06	mr1306	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	1.34E-06	mr1327	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	2.98E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	7.70E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	3.21E-07	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127	NA	8.08E-07	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251