Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318764531:

Variant ID: vg0318764531 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18764531
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAGGTTCCCGAAGCGTGGTTCGCGGTCATCGCCGAAGGTTCGGAAGGCCGTTATCTCTGAGCAAGGCAAGTCACATCATCCTTGAGCATATTGAATCC[T/C]
AGTTTATAAAATTATTTTGATTTAAATTATTGCATTATCGCTTTATTCAAATTCCCGCGTTATCACTGTTTTATTTAGCCATGCCTATTTATCTTTGTTA

Reverse complement sequence

TAACAAAGATAAATAGGCATGGCTAAATAAAACAGTGATAACGCGGGAATTTGAATAAAGCGATAATGCAATAATTTAAATCAAAATAATTTTATAAACT[A/G]
GGATTCAATATGCTCAAGGATGATGTGACTTGCCTTGCTCAGAGATAACGGCCTTCCGAACCTTCGGCGATGACCGCGAACCACGCTTCGGGAACCTCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	35.70%	12.23%	0.02%	NA
All Indica	2759	73.00%	8.40%	18.52%	0.04%	NA
All Japonica	1512	11.20%	86.30%	2.51%	0.00%	NA
Aus	269	82.50%	11.20%	6.32%	0.00%	NA
Indica I	595	51.30%	11.40%	37.14%	0.17%	NA
Indica II	465	80.60%	6.50%	12.90%	0.00%	NA
Indica III	913	81.60%	6.60%	11.83%	0.00%	NA
Indica Intermediate	786	74.90%	9.50%	15.52%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	29.60%	66.70%	3.77%	0.00%	NA
Japonica Intermediate	241	7.10%	85.10%	7.88%	0.00%	NA
VI/Aromatic	96	22.90%	71.90%	5.21%	0.00%	NA
Intermediate	90	37.80%	54.40%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318764531	T -> C	LOC_Os03g32780.1	upstream_gene_variant ; 1133.0bp to feature; MODIFIER	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N
vg0318764531	T -> C	LOC_Os03g32790.1	upstream_gene_variant ; 4079.0bp to feature; MODIFIER	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N
vg0318764531	T -> C	LOC_Os03g32790.2	upstream_gene_variant ; 4079.0bp to feature; MODIFIER	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N
vg0318764531	T -> C	LOC_Os03g32790.3	upstream_gene_variant ; 4079.0bp to feature; MODIFIER	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N
vg0318764531	T -> C	LOC_Os03g32770.1	downstream_gene_variant ; 4089.0bp to feature; MODIFIER	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N
vg0318764531	T -> C	LOC_Os03g32780-LOC_Os03g32790	intergenic_region ; MODIFIER	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N
vg0318764531	T -> DEL	N	N	silent_mutation	Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318764531	7.75E-06	NA	mr1158	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318764531	NA	6.70E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251