Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318566007:

Variant ID: vg0318566007 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18566007
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

ATTATCTAAACACCACGTCTAAGCAATTAATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATC[C/T]
CGTATGTTATTTAGGAACTAACTAAGAGATAATTCTCACAAGATAAATCTAAATTACTCAAGAAGAATATTATATTGAATTCAGAGTAATAAACAGAATA

Reverse complement sequence

TATTCTGTTTATTACTCTGAATTCAATATAATATTCTTCTTGAGTAATTTAGATTTATCTTGTGAGAATTATCTCTTAGTTAGTTCCTAAATAACATACG[G/A]
GATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATTAATTGCTTAGACGTGGTGTTTAGATAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	15.40%	0.11%	0.00%	NA
All Indica	2759	80.60%	19.20%	0.14%	0.00%	NA
All Japonica	1512	87.20%	12.80%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	76.80%	23.00%	0.22%	0.00%	NA
Indica III	913	70.40%	29.40%	0.22%	0.00%	NA
Indica Intermediate	786	84.50%	15.40%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	64.70%	35.30%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318566007	C -> T	LOC_Os03g32460.1	upstream_gene_variant ; 4201.0bp to feature; MODIFIER	silent_mutation	Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0318566007	C -> T	LOC_Os03g32470.1	upstream_gene_variant ; 4644.0bp to feature; MODIFIER	silent_mutation	Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0318566007	C -> T	LOC_Os03g32470.2	upstream_gene_variant ; 4644.0bp to feature; MODIFIER	silent_mutation	Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0318566007	C -> T	LOC_Os03g32460-LOC_Os03g32470	intergenic_region ; MODIFIER	silent_mutation	Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318566007	NA	1.71E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007	NA	4.81E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007	NA	1.57E-08	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007	NA	4.16E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007	NA	2.04E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007	2.43E-07	6.37E-08	mr1439_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007	NA	3.96E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251