Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318042099:

Variant ID: vg0318042099 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18042099
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGCACATAGGCCCTCACGTGTACACACGTGCACACCAATTAAAAAATGTCACCAAAAAATCTAGAAAAAATCATACACATACTTTCAATTGTATTACA[C/T]
CTAGGGTTAAAATGTTAACGTCAAATTCATTATATTTTAGCCGTAACAAAAAAACAAAAAATCTGACAGTTTTAAGGTTGCAATTTTGTCAAAATTTTAT

Reverse complement sequence

ATAAAATTTTGACAAAATTGCAACCTTAAAACTGTCAGATTTTTTGTTTTTTTGTTACGGCTAAAATATAATGAATTTGACGTTAACATTTTAACCCTAG[G/A]
TGTAATACAATTGAAAGTATGTGTATGATTTTTTCTAGATTTTTTGGTGACATTTTTTAATTGGTGTGCACGTGTGTACACGTGAGGGCCTATGTGCATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	6.20%	0.00%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	16.00%	84.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318042099	C -> T	LOC_Os03g31620.1	upstream_gene_variant ; 3918.0bp to feature; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0318042099	C -> T	LOC_Os03g31594.1	downstream_gene_variant ; 226.0bp to feature; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0318042099	C -> T	LOC_Os03g31594.2	downstream_gene_variant ; 226.0bp to feature; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg0318042099	C -> T	LOC_Os03g31594-LOC_Os03g31620	intergenic_region ; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318042099	NA	7.45E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	5.80E-06	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	NA	1.58E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	NA	2.23E-06	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	1.22E-06	NA	mr1243_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	NA	3.62E-21	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	NA	1.19E-11	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	NA	7.50E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099	NA	2.08E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251