RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0317879120:

Variant ID: vg0317879120 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17879120
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGTCCAGTCCGGAGTCGCCACGCGTCTCGCCGAGCGCTCCGCGCGTGCTCCAGCCTAGCGGGCCTACCTGCCAGCGAGCGAAGCCACCGCTCCCGCGC[G/A]
GCCGCGCGCGCTTGCCAAAACTGCGTGGGTCCCGCGCCATGCCGCGTCTCACACCTTTCCTGCCGATGCCGTGGTCCGTCGAACGGGAGGCCGCCACGTT

Reverse complement sequence

AACGTGGCGGCCTCCCGTTCGACGGACCACGGCATCGGCAGGAAAGGTGTGAGACGCGGCATGGCGCGGGACCCACGCAGTTTTGGCAAGCGCGCGCGGC[C/T]
GCGCGGGAGCGGTGGCTTCGCTCGCTGGCAGGTAGGCCCGCTAGGCTGGAGCACGCGCGGAGCGCTCGGCGAGACGCGTGGCGACTCCGGACTGGACGCG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	1.10%	2.03%	30.47%	NA
All Indica	2759	50.10%	1.80%	2.83%	45.23%	NA
All Japonica	1512	92.10%	0.00%	0.13%	7.74%	NA
Aus	269	81.00%	0.00%	5.20%	13.75%	NA
Indica I	595	39.70%	0.00%	3.70%	56.64%	NA
Indica II	465	62.40%	7.10%	3.44%	27.10%	NA
Indica III	913	39.80%	0.20%	1.86%	58.16%	NA
Indica Intermediate	786	62.80%	1.90%	2.93%	32.32%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	79.20%	0.00%	0.20%	20.63%	NA
Japonica Intermediate	241	94.60%	0.00%	0.41%	4.98%	NA
VI/Aromatic	96	82.30%	0.00%	1.04%	16.67%	NA
Intermediate	90	74.40%	0.00%	1.11%	24.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317879120	G -> A	LOC_Os03g31390.1	downstream_gene_variant ; 3798.0bp to feature; MODIFIER	silent_mutation	Average:25.034; most accessible tissue: Callus, score: 99.334	N	N	N	N
vg0317879120	G -> A	LOC_Os03g31370-LOC_Os03g31390	intergenic_region ; MODIFIER	silent_mutation	Average:25.034; most accessible tissue: Callus, score: 99.334	N	N	N	N
vg0317879120	G -> DEL	N	N	silent_mutation	Average:25.034; most accessible tissue: Callus, score: 99.334	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317879120	NA	2.75E-06	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	2.57E-15	3.46E-35	mr1498	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	1.25E-10	8.42E-26	mr1769	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	4.71E-06	4.71E-06	mr1916	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	6.86E-08	1.79E-14	mr1925	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	1.59E-12	4.57E-22	mr1951	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	8.28E-06	2.95E-11	mr1310_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	2.50E-11	2.80E-26	mr1498_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	3.04E-12	4.04E-31	mr1769_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317879120	6.51E-07	4.46E-09	mr1916_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 12 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0317879120:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact