Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316985667:

Variant ID: vg0316985667 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16985667
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.13, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTACAATTGAAGCAGAGTTCGGGCTTTTCTCCCAACCTCTTGGGCTGTTCTGGCAGAGCTGGCTGAACTGATTGAGCTGGAATCTTTAGTGAACTC[A/G]
GAGTAGGGTTGAGGCTGTGCTGCTCACTGTTGTTGTGACTATCACTATGGTGGTTCTTGTTGAAGCTACCCGGGTGGTAGGGACGGTACTGCCGGATAAT

Reverse complement sequence

ATTATCCGGCAGTACCGTCCCTACCACCCGGGTAGCTTCAACAAGAACCACCATAGTGATAGTCACAACAACAGTGAGCAGCACAGCCTCAACCCTACTC[T/C]
GAGTTCACTAAAGATTCCAGCTCAATCAGTTCAGCCAGCTCTGCCAGAACAGCCCAAGAGGTTGGGAGAAAAGCCCGAACTCTGCTTCAATTGTAACAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 0.10% 7.34% 14.05% NA
All Indica  2759 66.80% 0.10% 11.60% 21.49% NA
All Japonica  1512 94.20% 0.20% 1.59% 4.03% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 58.70% 0.00% 16.47% 24.87% NA
Indica II  465 81.90% 0.20% 3.66% 14.19% NA
Indica III  913 63.50% 0.00% 13.80% 22.67% NA
Indica Intermediate  786 67.70% 0.40% 10.05% 21.88% NA
Temperate Japonica  767 89.40% 0.40% 3.13% 7.04% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 97.50% 0.00% 0.00% 2.49% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 91.10% 0.00% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316985667 A -> DEL LOC_Os03g29790.1 N frameshift_variant Average:37.893; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N
vg0316985667 A -> G LOC_Os03g29790.1 missense_variant ; p.Leu368Pro; MODERATE nonsynonymous_codon ; L368P Average:37.893; most accessible tissue: Minghui63 flag leaf, score: 87.98 possibly damaging -1.728 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316985667 A G -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316985667 1.57E-06 1.01E-06 mr1252 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 1.13E-06 NA mr1280 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 4.35E-07 4.81E-06 mr1283 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 5.61E-06 5.63E-06 mr1306 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 5.56E-07 1.69E-06 mr1318 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 4.02E-06 4.02E-06 mr1605 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 6.91E-06 NA mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 7.59E-06 NA mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316985667 5.04E-07 3.95E-06 mr1788 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251