Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316691399:

Variant ID: vg0316691399 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16691399
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TATTCAAAAACTTTTGTGAAATGTGTAAAACTATATATATACATAAAAGTATATTTAACAATAAATTAAATGATAGAAAAAGAATTAATAATTACTTAAA[T/A]
TTTTTGAATAAGACGAACGGTCAAACATTTTTTAAAAAGTCAACGGCGTCAAACATTTTAGGATGGAGGGAGTATTTCTTATTCTAGGTTTCTATGAGAG

Reverse complement sequence

CTCTCATAGAAACCTAGAATAAGAAATACTCCCTCCATCCTAAAATGTTTGACGCCGTTGACTTTTTAAAAAATGTTTGACCGTTCGTCTTATTCAAAAA[A/T]
TTTAAGTAATTATTAATTCTTTTTCTATCATTTAATTTATTGTTAAATATACTTTTATGTATATATATAGTTTTACACATTTCACAAAAGTTTTTGAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	39.40%	5.21%	5.73%	NA
All Indica	2759	35.70%	55.60%	1.99%	6.74%	NA
All Japonica	1512	74.90%	8.30%	11.90%	4.89%	NA
Aus	269	29.40%	69.50%	1.12%	0.00%	NA
Indica I	595	10.90%	82.90%	2.02%	4.20%	NA
Indica II	465	67.10%	15.30%	4.52%	13.12%	NA
Indica III	913	37.70%	58.50%	0.55%	3.29%	NA
Indica Intermediate	786	33.50%	55.50%	2.16%	8.91%	NA
Temperate Japonica	767	70.10%	0.30%	20.73%	8.87%	NA
Tropical Japonica	504	74.40%	23.60%	1.39%	0.60%	NA
Japonica Intermediate	241	90.90%	2.10%	5.81%	1.24%	NA
VI/Aromatic	96	95.80%	1.00%	1.04%	2.08%	NA
Intermediate	90	64.40%	17.80%	7.78%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316691399	T -> A	LOC_Os03g29330.1	upstream_gene_variant ; 539.0bp to feature; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> A	LOC_Os03g29340.1	upstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> A	LOC_Os03g29340.2	upstream_gene_variant ; 1120.0bp to feature; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> A	LOC_Os03g29350.1	downstream_gene_variant ; 4523.0bp to feature; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> A	LOC_Os03g29350.2	downstream_gene_variant ; 4523.0bp to feature; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> A	LOC_Os03g29350.4	downstream_gene_variant ; 4523.0bp to feature; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> A	LOC_Os03g29330-LOC_Os03g29340	intergenic_region ; MODIFIER	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N
vg0316691399	T -> DEL	N	N	silent_mutation	Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316691399	NA	7.01E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316691399	1.71E-06	2.32E-09	mr1090_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316691399	NA	4.40E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316691399	NA	6.30E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251