Search for Variation information by Variation ID:
Detailed information for vg0316348387:
| Variant ID: vg0316348387 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16348387 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GACATCCCATACAACTACAATGCCATCTTCGGCCGTGCAACCTTGAACAAGTTCGAAGCCATTTCCCATCACAATTATCTCAAGCTCAAGATGTATGGCC[C/T]
GGCAGGAGTGATCGTGGTCAAGGGGCTTCAGCTTCGGCTGCTTTAAAAGGCGATTTGGCCATAATCAATAGAGCAGTGCACAATGTTGAGGCCGAACCGC
Reverse complement sequence
GCGGTTCGGCCTCAACATTGTGCACTGCTCTATTGATTATGGCCAAATCGCCTTTTAAAGCAGCCGAAGCTGAAGCCCCTTGACCACGATCACTCCTGCC[G/A]
GGCCATACATCTTGAGCTTGAGATAATTGTGATGGGAAATGGCTTCGAACTTGTTCAAGGTTGCACGGCCGAAGATGGCATTGTAGTTGTATGGGATGTC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 5.90% | 2.35% | 3.11% | NA |
| All Indica | 2759 | 95.40% | 0.30% | 3.44% | 0.83% | NA |
| All Japonica | 1512 | 74.40% | 17.40% | 0.33% | 7.87% | NA |
| Aus | 269 | 96.70% | 0.00% | 2.97% | 0.37% | NA |
| Indica I | 595 | 96.80% | 0.00% | 1.68% | 1.51% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.60% | 0.80% | 7.12% | 0.55% | NA |
| Indica Intermediate | 786 | 96.10% | 0.30% | 2.54% | 1.15% | NA |
| Temperate Japonica | 767 | 97.00% | 0.30% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 38.30% | 49.20% | 0.99% | 11.51% | NA |
| Japonica Intermediate | 241 | 78.00% | 5.40% | 0.00% | 16.60% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 91.10% | 5.60% | 1.11% | 2.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316348387 | C -> T | LOC_Os03g28370.1 | missense_variant ; p.Pro633Leu; MODERATE | nonsynonymous_codon ; P633L | Average:41.795; most accessible tissue: Zhenshan97 root, score: 67.648 | probably damaging  |
2.204 |
TOLERATED | 0.11 |
| vg0316348387 | C -> DEL | LOC_Os03g28370.1 | N | frameshift_variant | Average:41.795; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316348387 | NA | 7.92E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316348387 | NA | 4.21E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316348387 | NA | 5.62E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316348387 | 2.05E-06 | NA | mr1676_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316348387 | NA | 7.70E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316348387 | NA | 1.32E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |