Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316262550:

Variant ID: vg0316262550 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16262550
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, T: 0.43, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGCCGCCGGCGCCCTCGCCACCGCCCGTGCCTCCCCCGGGTCCGGTCTCGGGCGGGCTCGGCAGTCGGCACGGCCTGGAGAGAGGAGGAAGAAAGGTG[G/T]
GATGAGAATGACATGTGGGGCCCAGGTAGGCTCCACCATTTTTTTAATTATTTTTTTATCTGACACGTGGGCCATGTTTTTTATTATTTTCTAAATCAAA

Reverse complement sequence

TTTGATTTAGAAAATAATAAAAAACATGGCCCACGTGTCAGATAAAAAAATAATTAAAAAAATGGTGGAGCCTACCTGGGCCCCACATGTCATTCTCATC[C/A]
CACCTTTCTTCCTCCTCTCTCCAGGCCGTGCCGACTGCCGAGCCCGCCCGAGACCGGACCCGGGGGAGGCACGGGCGGTGGCGAGGGCGCCGGCGGCAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 40.60% 0.42% 3.32% NA
All Indica  2759 85.20% 12.80% 0.47% 1.56% NA
All Japonica  1512 12.10% 87.80% 0.07% 0.07% NA
Aus  269 14.50% 43.10% 1.86% 40.52% NA
Indica I  595 65.20% 34.80% 0.00% 0.00% NA
Indica II  465 95.50% 3.90% 0.00% 0.65% NA
Indica III  913 94.10% 3.80% 0.66% 1.42% NA
Indica Intermediate  786 84.00% 11.70% 0.89% 3.44% NA
Temperate Japonica  767 3.40% 96.50% 0.13% 0.00% NA
Tropical Japonica  504 22.00% 78.00% 0.00% 0.00% NA
Japonica Intermediate  241 19.10% 80.50% 0.00% 0.41% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 52.20% 43.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316262550 G -> T LOC_Os03g28270.1 intron_variant ; MODIFIER silent_mutation Average:96.29; most accessible tissue: Minghui63 young leaf, score: 98.847 N N N N
vg0316262550 G -> DEL N N silent_mutation Average:96.29; most accessible tissue: Minghui63 young leaf, score: 98.847 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316262550 G T -0.08 -0.13 -0.11 -0.05 -0.07 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316262550 NA 3.97E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316262550 NA 3.02E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316262550 NA 6.17E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316262550 NA 2.58E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316262550 NA 2.83E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316262550 NA 9.26E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316262550 NA 3.17E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316262550 4.05E-06 6.57E-07 mr1899_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251