RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0316104224:

Variant ID: vg0316104224 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16104224
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACTCCTCCTCTCTCCTCTCCCAAACCCTAGCCATCTCCCTCCATCAAATCCATTCGGTTTGACCGCGGATTTCTCTCCAGTTACACCGTAAGTGATT[C/A]
TCCTCCGCTTCCTCTCTCTATTCCATGGATTGGTTTGTGTTTTTGTTGAGTTTTTGATCCATGGCATGGAACCCTAGGTGAAGCACGAGGTGTTCTTCGA

Reverse complement sequence

TCGAAGAACACCTCGTGCTTCACCTAGGGTTCCATGCCATGGATCAAAAACTCAACAAAAACACAAACCAATCCATGGAATAGAGAGAGGAAGCGGAGGA[G/T]
AATCACTTACGGTGTAACTGGAGAGAAATCCGCGGTCAAACCGAATGGATTTGATGGAGGGAGATGGCTAGGGTTTGGGAGAGGAGAGAGGAGGAGTTTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	5.50%	0.04%	0.00%	NA
All Indica	2759	97.50%	2.50%	0.07%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.50%	3.30%	0.22%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316104224	C -> A	LOC_Os03g28020.1	upstream_gene_variant ; 604.0bp to feature; MODIFIER	silent_mutation	Average:46.719; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0316104224	C -> A	LOC_Os03g28010.1	downstream_gene_variant ; 1024.0bp to feature; MODIFIER	silent_mutation	Average:46.719; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0316104224	C -> A	LOC_Os03g28010-LOC_Os03g28020	intergenic_region ; MODIFIER	silent_mutation	Average:46.719; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316104224	9.35E-06	1.03E-29	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	NA	2.90E-15	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	NA	2.65E-19	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	NA	1.70E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	NA	2.45E-20	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	3.51E-07	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	NA	1.18E-17	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	1.13E-08	1.37E-29	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	NA	1.58E-17	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224	3.18E-07	5.20E-22	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0316104224:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact