Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316104224:

Variant ID: vg0316104224 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16104224
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACTCCTCCTCTCTCCTCTCCCAAACCCTAGCCATCTCCCTCCATCAAATCCATTCGGTTTGACCGCGGATTTCTCTCCAGTTACACCGTAAGTGATT[C/A]
TCCTCCGCTTCCTCTCTCTATTCCATGGATTGGTTTGTGTTTTTGTTGAGTTTTTGATCCATGGCATGGAACCCTAGGTGAAGCACGAGGTGTTCTTCGA

Reverse complement sequence

TCGAAGAACACCTCGTGCTTCACCTAGGGTTCCATGCCATGGATCAAAAACTCAACAAAAACACAAACCAATCCATGGAATAGAGAGAGGAAGCGGAGGA[G/T]
AATCACTTACGGTGTAACTGGAGAGAAATCCGCGGTCAAACCGAATGGATTTGATGGAGGGAGATGGCTAGGGTTTGGGAGAGGAGAGAGGAGGAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 5.50% 0.04% 0.00% NA
All Indica  2759 97.50% 2.50% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 33.80% 66.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.50% 3.30% 0.22% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316104224 C -> A LOC_Os03g28020.1 upstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:46.719; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0316104224 C -> A LOC_Os03g28010.1 downstream_gene_variant ; 1024.0bp to feature; MODIFIER silent_mutation Average:46.719; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0316104224 C -> A LOC_Os03g28010-LOC_Os03g28020 intergenic_region ; MODIFIER silent_mutation Average:46.719; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316104224 9.35E-06 1.03E-29 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 2.90E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 2.65E-19 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.70E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 2.45E-20 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 3.51E-07 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.18E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 1.13E-08 1.37E-29 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.58E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 3.18E-07 5.20E-22 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 2.56E-06 4.54E-24 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.17E-16 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 9.34E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 3.97E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 6.69E-08 1.03E-29 mr1858 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 6.26E-08 9.35E-30 mr1859 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 6.42E-19 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 7.95E-19 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.37E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 5.18E-19 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 9.42E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 2.16E-18 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 8.41E-07 7.07E-25 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.71E-20 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 1.78E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 NA 1.50E-22 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 8.37E-06 6.96E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316104224 4.05E-06 6.19E-18 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251