Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315854657:

Variant ID: vg0315854657 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15854657
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACGGCCGTCATGAATAAATATATCTCAATCGGGCCCTAAGTAAAGCCCGTCACCGATACTTTGACCTAGACGACCAGTCAAACTATAGCCCGTCACAGA[T/C]
GACCTATCTCTATCGGACCACAACTAGCGCCCGTCACAGATGACTACTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATGATACTCATCTCAAT

Reverse complement sequence

ATTGAGATGAGTATCATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAGTAGTCATCTGTGACGGGCGCTAGTTGTGGTCCGATAGAGATAGGTC[A/G]
TCTGTGACGGGCTATAGTTTGACTGGTCGTCTAGGTCAAAGTATCGGTGACGGGCTTTACTTAGGGCCCGATTGAGATATATTTATTCATGACGGCCGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.00%	0.28%	0.00%	NA
All Indica	2759	88.90%	10.80%	0.33%	0.00%	NA
All Japonica	1512	22.20%	77.60%	0.13%	0.00%	NA
Aus	269	37.90%	62.10%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	88.60%	10.50%	0.86%	0.00%	NA
Indica III	913	79.40%	20.30%	0.33%	0.00%	NA
Indica Intermediate	786	92.40%	7.40%	0.25%	0.00%	NA
Temperate Japonica	767	4.30%	95.70%	0.00%	0.00%	NA
Tropical Japonica	504	48.00%	51.60%	0.40%	0.00%	NA
Japonica Intermediate	241	25.30%	74.70%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315854657	T -> C	LOC_Os03g27670.1	downstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:56.0; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0315854657	T -> C	LOC_Os03g27640-LOC_Os03g27670	intergenic_region ; MODIFIER	silent_mutation	Average:56.0; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315854657	NA	4.42E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	1.33E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	2.01E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	1.06E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	3.24E-06	mr1233_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	5.41E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	3.38E-06	3.38E-06	mr1416_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	2.33E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315854657	NA	3.88E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251