| Variant ID: vg0315756494 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15756494 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACGAATAAACGTTGGTCGAAAAGTCAACGGCGTCATACATAAAAAACCAACCTATACAACGATGGGACAATACATAGTACAACGAATCTACCCTTTTTAT[G/A]
GGACGGAGGGAGTACTGTACAAGAAAAAAAATATTTAATTTCTGCCTAAATAATAAATATCTGAGTATTTGTTTAGGCAACAATTAATATTATTGCTATA
TATAGCAATAATATTAATTGTTGCCTAAACAAATACTCAGATATTTATTATTTAGGCAGAAATTAAATATTTTTTTTCTTGTACAGTACTCCCTCCGTCC[C/T]
ATAAAAAGGGTAGATTCGTTGTACTATGTATTGTCCCATCGTTGTATAGGTTGGTTTTTTATGTATGACGCCGTTGACTTTTCGACCAACGTTTATTCGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 28.20% | 0.30% | 3.22% | NA |
| All Indica | 2759 | 96.10% | 2.90% | 0.51% | 0.51% | NA |
| All Japonica | 1512 | 25.40% | 74.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.00% | 10.40% | 0.00% | 47.58% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.10% | 5.70% | 0.44% | 0.77% | NA |
| Indica Intermediate | 786 | 95.30% | 2.50% | 1.27% | 0.89% | NA |
| Temperate Japonica | 767 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 25.30% | 74.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 76.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 66.70% | 28.90% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315756494 | G -> A | LOC_Os03g27460.1 | upstream_gene_variant ; 388.0bp to feature; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> A | LOC_Os03g27470.1 | upstream_gene_variant ; 1064.0bp to feature; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> A | LOC_Os03g27460.2 | upstream_gene_variant ; 388.0bp to feature; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> A | LOC_Os03g27460.3 | upstream_gene_variant ; 388.0bp to feature; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> A | LOC_Os03g27450.1 | downstream_gene_variant ; 4116.0bp to feature; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> A | LOC_Os03g27450.2 | downstream_gene_variant ; 4529.0bp to feature; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> A | LOC_Os03g27460-LOC_Os03g27470 | intergenic_region ; MODIFIER | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| vg0315756494 | G -> DEL | N | N | silent_mutation | Average:66.143; most accessible tissue: Callus, score: 75.223 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315756494 | NA | 5.43E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 2.45E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 2.39E-21 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 1.20E-08 | mr1502 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 4.08E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 3.21E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 8.03E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 5.98E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 5.49E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315756494 | NA | 2.77E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |