Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315387307:

Variant ID: vg0315387307 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15387307
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAATCTCTAGGTGAAAACCTTGTTCCGATTTTCGGACGAACGGCGGCGGCGTTACGCGTCGTGTCCTCCTTGGGGGCGTCGCTTCGGAGAAGTTCCAA[C/T]
GCATCGATGACTATCGATGGTCCTTTTCGGTTCAATAGCTTGCATACCTTGCGTTTGGTGAGGCCTTCGCCTTCTTGGGTCCACTTCTTTCTTGTGGTGG

Reverse complement sequence

CCACCACAAGAAAGAAGTGGACCCAAGAAGGCGAAGGCCTCACCAAACGCAAGGTATGCAAGCTATTGAACCGAAAAGGACCATCGATAGTCATCGATGC[G/A]
TTGGAACTTCTCCGAAGCGACGCCCCCAAGGAGGACACGACGCGTAACGCCGCCGCCGTTCGTCCGAAAATCGGAACAAGGTTTTCACCTAGAGATTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 4.90% 0.23% 0.87% NA
All Indica  2759 98.60% 1.30% 0.04% 0.04% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 20.10% 62.10% 3.35% 14.50% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.60% 0.13% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315387307 C -> T LOC_Os03g26910.1 downstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:72.839; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0315387307 C -> T LOC_Os03g26910-LOC_Os03g26920 intergenic_region ; MODIFIER silent_mutation Average:72.839; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0315387307 C -> DEL N N silent_mutation Average:72.839; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315387307 NA 1.31E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.77E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.72E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.83E-46 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.39E-51 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.72E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.90E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 3.49E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.05E-44 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.05E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.10E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.12E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 9.14E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.92E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.07E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.50E-14 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.13E-38 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.15E-55 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 2.01E-18 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.24E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 1.67E-35 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315387307 NA 5.31E-10 mr1762_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251