Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315359335:

Variant ID: vg0315359335 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15359335
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGATAAGATCGGCTGAAACTCCGATACTACCCTAATCGGCAACCAGAAGGCAGGTTAGAGATTGGTATTCTAAGCACGACTTAATAGATCAAACTCAA[C/A]
TGATGCAGCATTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAGTCGCTGGAAGTTTCATAGAGTGGTAGATATCTTACATAATCTAAATCAACGT

Reverse complement sequence

ACGTTGATTTAGATTATGTAAGATATCTACCACTCTATGAAACTTCCAGCGACTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAATGCTGCATCA[G/T]
TTGAGTTTGATCTATTAAGTCGTGCTTAGAATACCAATCTCTAACCTGCCTTCTGGTTGCCGATTAGGGTAGTATCGGAGTTTCAGCCGATCTTATCTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	9.00%	3.20%	0.00%	NA
All Indica	2759	92.40%	4.50%	3.15%	0.00%	NA
All Japonica	1512	90.90%	8.60%	0.53%	0.00%	NA
Aus	269	22.30%	58.40%	19.33%	0.00%	NA
Indica I	595	94.10%	2.40%	3.53%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	89.80%	7.30%	2.85%	0.00%	NA
Indica Intermediate	786	89.60%	5.30%	5.09%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	74.40%	24.00%	1.59%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	3.10%	2.08%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315359335	C -> A	LOC_Os03g26890.1	upstream_gene_variant ; 2472.0bp to feature; MODIFIER	silent_mutation	Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg0315359335	C -> A	LOC_Os03g26900.1	upstream_gene_variant ; 738.0bp to feature; MODIFIER	silent_mutation	Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N
vg0315359335	C -> A	LOC_Os03g26900-LOC_Os03g26910	intergenic_region ; MODIFIER	silent_mutation	Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315359335	8.25E-06	NA	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	4.38E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	3.16E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	3.51E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	7.60E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	9.02E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	9.05E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	NA	4.17E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	3.72E-06	1.46E-07	mr1948	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335	5.30E-06	5.30E-06	mr1314_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251