RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0315358592:

Variant ID: vg0315358592 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15358592
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCACGACGTTCGCTTCATTGACGTCGGTCAATCCTACCTTCTGGATCTTTTCCTTGACAGTGCCTGGGCTAGCCGAGGATGGTGACAGCGGTAGTTTCTT[G/A]
GCCATCGGGAAGAATTGCTTGCTGACTTCTTATCGGTCCCACCAGGCGTGCCAAAAGCGTGTTGATGAAAAACACGAGGCCTGGGAGATCTGCTTAACTC

Reverse complement sequence

GAGTTAAGCAGATCTCCCAGGCCTCGTGTTTTTCATCAACACGCTTTTGGCACGCCTGGTGGGACCGATAAGAAGTCAGCAAGCAATTCTTCCCGATGGC[C/T]
AAGAAACTACCGCTGTCACCATCCTCGGCTAGCCCAGGCACTGTCAAGGAAAAGATCCAGAAGGTAGGATTGACCGACGTCAATGAAGCGAACGTCGTGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	14.30%	0.11%	0.00%	NA
All Indica	2759	91.40%	8.40%	0.14%	0.00%	NA
All Japonica	1512	89.70%	10.30%	0.00%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	93.80%	6.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	88.60%	11.30%	0.11%	0.00%	NA
Indica Intermediate	786	87.80%	11.80%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	71.20%	28.80%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315358592	G -> A	LOC_Os03g26900.1	synonymous_variant ; p.Ala2Ala; LOW	synonymous_codon	Average:43.318; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0315358592	G -> A	LOC_Os03g26900.1	synonymous_variant ; p.Ala2Ala; LOW	nonsynonymous_codon ; A2V	Average:43.318; most accessible tissue: Minghui63 flag leaf, score: 61.847	unknown	unknown	DELETERIOUS	0.05

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315358592	NA	9.51E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	9.13E-07	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	3.46E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	8.87E-07	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	5.21E-10	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	1.02E-07	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	2.00E-08	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	2.57E-07	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	3.35E-06	1.49E-11	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315358592	NA	9.54E-06	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 90 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0315358592:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact