Search for Variation information by Variation ID:
Detailed information for vg0315356844:
| Variant ID: vg0315356844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15356844 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )
Flanking Sequence (100 bp) in Reference Genome:
CTGGGCATCAGTCAAACTCAAGCTGTAACACTTATTTCTCATCTCCCTGAATCTCTGAATATACTCATGTACTGGCTCATCATGCTTTTGCTTGATCAAC[A/G]
TCAGATCAGACAATTTCATCTCATGAATCCCACTCTAGAAATAGCTATGAAACTGCTTTTCTAAATCAGCCCAGCTGTTAATTGATCCATATGGTAAAGA
Reverse complement sequence
TCTTTACCATATGGATCAATTAACAGCTGGGCTGATTTAGAAAAGCAGTTTCATAGCTATTTCTAGAGTGGGATTCATGAGATGAAATTGTCTGATCTGA[T/C]
GTTGATCAAGCAAAAGCATGATGAGCCAGTACATGAGTATATTCAGAGATTCAGGGAGATGAGAAATAAGTGTTACAGCTTGAGTTTGACTGATGCCCAG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.70% | 20.00% | 4.61% | 54.63% | NA |
| All Indica | 2759 | 11.00% | 4.70% | 3.77% | 80.54% | NA |
| All Japonica | 1512 | 19.40% | 52.80% | 7.08% | 20.77% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 4.20% | 3.90% | 2.52% | 89.41% | NA |
| Indica II | 465 | 9.20% | 0.40% | 4.52% | 85.81% | NA |
| Indica III | 913 | 15.70% | 7.10% | 4.71% | 72.51% | NA |
| Indica Intermediate | 786 | 11.80% | 5.00% | 3.18% | 80.03% | NA |
| Temperate Japonica | 767 | 8.50% | 84.40% | 1.69% | 5.48% | NA |
| Tropical Japonica | 504 | 36.30% | 17.30% | 9.52% | 36.90% | NA |
| Japonica Intermediate | 241 | 18.70% | 26.60% | 19.09% | 35.68% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 32.20% | 20.00% | 5.56% | 42.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315356844 | A -> DEL | LOC_Os03g26890.1 | N | frameshift_variant | Average:33.848; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg0315356844 | A -> G | LOC_Os03g26890.1 | missense_variant ; p.Met7Thr; MODERATE | nonsynonymous_codon ; M7T | Average:33.848; most accessible tissue: Minghui63 flag leaf, score: 64.867 | benign  |
-0.708 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315356844 | 3.03E-06 | NA | mr1139 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 4.46E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 6.73E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 2.34E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 6.15E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 1.84E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 1.32E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 5.49E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 2.83E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315356844 | NA | 3.91E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |