Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315336415:

Variant ID: vg0315336415 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15336415
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTAGACATATATGTACCTAGATTCATTAATATCTATAAGAATGTGAGCAATGCTAGAAAGTCTTATAATCTGAAACGAAGGTAACTCTTTTCATGAGA[T/C]
AGGTTTTTGTGATTTTTTAGAAATTATTCTTCGCATGGACCATAGCCCACTCAATAATTCTAATACTTCCAAGCTCTGAACTGATTCGTCTAGGCTCCCA

Reverse complement sequence

TGGGAGCCTAGACGAATCAGTTCAGAGCTTGGAAGTATTAGAATTATTGAGTGGGCTATGGTCCATGCGAAGAATAATTTCTAAAAAATCACAAAAACCT[A/G]
TCTCATGAAAAGAGTTACCTTCGTTTCAGATTATAAGACTTTCTAGCATTGCTCACATTCTTATAGATATTAATGAATCTAGGTACATATATGTCTAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 20.10% 0.11% 0.00% NA
All Indica  2759 87.20% 12.60% 0.11% 0.00% NA
All Japonica  1512 85.10% 14.90% 0.07% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 93.60% 6.40% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 80.50% 19.40% 0.11% 0.00% NA
Indica Intermediate  786 86.60% 13.10% 0.25% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 66.10% 33.70% 0.20% 0.00% NA
Japonica Intermediate  241 83.80% 16.20% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315336415 T -> C LOC_Os03g26870.1 downstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:96.627; most accessible tissue: Zhenshan97 young leaf, score: 99.025 N N N N
vg0315336415 T -> C LOC_Os03g26870.2 downstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:96.627; most accessible tissue: Zhenshan97 young leaf, score: 99.025 N N N N
vg0315336415 T -> C LOC_Os03g26870-LOC_Os03g26880 intergenic_region ; MODIFIER silent_mutation Average:96.627; most accessible tissue: Zhenshan97 young leaf, score: 99.025 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315336415 T C -0.01 -0.01 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315336415 NA 3.11E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.88E-06 mr1060 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.22E-08 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 4.11E-08 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 8.45E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 4.32E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 2.10E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 2.34E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.96E-15 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.08E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 3.40E-07 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.18E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 9.25E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.84E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 2.64E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.20E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 2.84E-07 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.04E-11 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 5.80E-08 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 4.65E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.87E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 5.90E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 3.13E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.32E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.19E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 4.32E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 4.88E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.11E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.15E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 6.09E-08 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 1.00E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 2.58E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315336415 NA 6.01E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251