| Variant ID: vg0315320771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15320771 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACAAATTACAGATTCCGCCTGTAAACTACGAGAGAAATTTATTAAGCCTAATTGTAGCACCACATTGTCAAATCATGGAGCAATTAGGCTTAAAAGATT[C/T]
GTCTCGCAATTTACACGCAATCTGTGTAATTAGTTATTTTTTATCTATATTTAATACTACTTCATACATATGTCTAAATATTCGATGTGATTTGGTGAAA
TTTCACCAAATCACATCGAATATTTAGACATATGTATGAAGTAGTATTAAATATAGATAAAAAATAACTAATTACACAGATTGCGTGTAAATTGCGAGAC[G/A]
AATCTTTTAAGCCTAATTGCTCCATGATTTGACAATGTGGTGCTACAATTAGGCTTAATAAATTTCTCTCGTAGTTTACAGGCGGAATCTGTAATTTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 15.80% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 90.40% | 9.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.40% | 16.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 12.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 73.40% | 26.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315320771 | C -> T | LOC_Os03g26840.1 | upstream_gene_variant ; 4238.0bp to feature; MODIFIER | silent_mutation | Average:44.299; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0315320771 | C -> T | LOC_Os03g26850.1 | downstream_gene_variant ; 1428.0bp to feature; MODIFIER | silent_mutation | Average:44.299; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0315320771 | C -> T | LOC_Os03g26860.1 | downstream_gene_variant ; 1091.0bp to feature; MODIFIER | silent_mutation | Average:44.299; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0315320771 | C -> T | LOC_Os03g26850-LOC_Os03g26860 | intergenic_region ; MODIFIER | silent_mutation | Average:44.299; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315320771 | NA | 8.03E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 2.27E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 3.68E-09 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 1.44E-07 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 1.40E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 1.97E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 5.14E-11 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 9.54E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 4.19E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315320771 | NA | 2.41E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/