Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315253958:

Variant ID: vg0315253958 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15253958
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAAATCCTTGTCTCCGCATCCATCCACTTTTAGGTCTCGTGCGCTACCCCTTTTATTATTGCCGAATTCATATTTCGACAGTTGGCGCGCCAGGTAGG[A/G]
GTGCGTCGAATTATCTGTCAAGAAGTGTGATGGAATCAACCTGAGTCGCCGGCATCATCCTCCCTCGAGTTTCATGGATTCTGCCGTCATCAACGCAATC

Reverse complement sequence

GATTGCGTTGATGACGGCAGAATCCATGAAACTCGAGGGAGGATGATGCCGGCGACTCAGGTTGATTCCATCACACTTCTTGACAGATAATTCGACGCAC[T/C]
CCTACCTGGCGCGCCAACTGTCGAAATATGAATTCGGCAATAATAAAAGGGGTAGCGCACGAGACCTAAAAGTGGATGGATGCGGAGACAAGGATTTAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	19.50%	3.81%	24.52%	NA
All Indica	2759	34.30%	29.00%	3.59%	33.13%	NA
All Japonica	1512	78.10%	6.20%	4.50%	11.18%	NA
Aus	269	78.40%	1.90%	2.97%	16.73%	NA
Indica I	595	53.10%	19.80%	3.03%	24.03%	NA
Indica II	465	38.10%	16.30%	4.09%	41.51%	NA
Indica III	913	20.30%	40.70%	2.96%	36.04%	NA
Indica Intermediate	786	34.10%	29.80%	4.45%	31.68%	NA
Temperate Japonica	767	96.30%	1.00%	1.17%	1.43%	NA
Tropical Japonica	504	50.60%	12.50%	10.52%	26.39%	NA
Japonica Intermediate	241	77.60%	9.50%	2.49%	10.37%	NA
VI/Aromatic	96	78.10%	4.20%	1.04%	16.67%	NA
Intermediate	90	58.90%	20.00%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315253958	A -> DEL	N	N	silent_mutation	Average:41.47; most accessible tissue: Callus, score: 75.667	N	N	N	N
vg0315253958	A -> G	LOC_Os03g26704.1	upstream_gene_variant ; 4026.0bp to feature; MODIFIER	silent_mutation	Average:41.47; most accessible tissue: Callus, score: 75.667	N	N	N	N
vg0315253958	A -> G	LOC_Os03g26720.1	upstream_gene_variant ; 1935.0bp to feature; MODIFIER	silent_mutation	Average:41.47; most accessible tissue: Callus, score: 75.667	N	N	N	N
vg0315253958	A -> G	LOC_Os03g26730.1	upstream_gene_variant ; 1162.0bp to feature; MODIFIER	silent_mutation	Average:41.47; most accessible tissue: Callus, score: 75.667	N	N	N	N
vg0315253958	A -> G	LOC_Os03g26720-LOC_Os03g26730	intergenic_region ; MODIFIER	silent_mutation	Average:41.47; most accessible tissue: Callus, score: 75.667	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315253958	2.32E-06	NA	mr1280	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958	6.04E-07	NA	mr1280	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958	2.15E-06	2.15E-06	mr1345	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958	9.70E-06	9.70E-06	mr1485	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315253958	8.77E-06	8.77E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251