Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315005601:

Variant ID: vg0315005601 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15005601
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTAATTGTTGCAAGAGCACGGAAAATTAAGTGCTTCTTATCACAGTTGATAGCATACTAGGATTAATTAATTGGAGGTCATATAAAACCAAGATTCAA[T/C]
GTATTATACTACACCAGTGTTAGTAAAATATTTGTAATGATTCTTTTTTATGCATATAGCTTCTTCTTTAGAAGAATTTGGAATTCCTTTACCACACGTA

Reverse complement sequence

TACGTGTGGTAAAGGAATTCCAAATTCTTCTAAAGAAGAAGCTATATGCATAAAAAAGAATCATTACAAATATTTTACTAACACTGGTGTAGTATAATAC[A/G]
TTGAATCTTGGTTTTATATGACCTCCAATTAATTAATCCTAGTATGCTATCAACTGTGATAAGAAGCACTTAATTTTCCGTGCTCTTGCAACAATTAAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 41.30% 0.11% 0.00% NA
All Indica  2759 71.10% 28.90% 0.00% 0.00% NA
All Japonica  1512 43.60% 56.20% 0.26% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 46.20% 53.80% 0.00% 0.00% NA
Indica II  465 51.40% 48.60% 0.00% 0.00% NA
Indica III  913 89.40% 10.60% 0.00% 0.00% NA
Indica Intermediate  786 80.30% 19.70% 0.00% 0.00% NA
Temperate Japonica  767 17.90% 81.60% 0.52% 0.00% NA
Tropical Japonica  504 64.50% 35.50% 0.00% 0.00% NA
Japonica Intermediate  241 81.70% 18.30% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315005601 T -> C LOC_Os03g26220.1 upstream_gene_variant ; 1038.0bp to feature; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0315005601 T -> C LOC_Os03g26229.1 upstream_gene_variant ; 294.0bp to feature; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0315005601 T -> C LOC_Os03g26210.1 downstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0315005601 T -> C LOC_Os03g26240.1 downstream_gene_variant ; 3154.0bp to feature; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0315005601 T -> C LOC_Os03g26210.3 downstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0315005601 T -> C LOC_Os03g26210.2 downstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0315005601 T -> C LOC_Os03g26220-LOC_Os03g26229 intergenic_region ; MODIFIER silent_mutation Average:62.779; most accessible tissue: Minghui63 root, score: 86.064 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315005601 T C 0.03 0.04 0.03 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315005601 NA 2.91E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 3.69E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 4.49E-06 4.49E-06 mr1169 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 1.03E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 4.81E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 7.25E-06 7.25E-06 mr1198 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 1.51E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 9.80E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 2.26E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 4.07E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 2.78E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 3.08E-06 mr1293 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 2.85E-06 mr1315 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 5.14E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 1.65E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 2.15E-06 2.15E-06 mr1393 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 1.88E-06 1.88E-06 mr1412 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 2.91E-06 2.91E-06 mr1430 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 2.26E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 7.58E-06 mr1507 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 2.42E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 3.99E-07 3.99E-07 mr1556 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 6.11E-08 mr1576 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 3.39E-07 2.79E-08 mr1683 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 4.07E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 1.19E-09 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 7.17E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 3.90E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 2.45E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 6.07E-07 mr1809 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 NA 1.82E-06 mr1810 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005601 1.35E-06 1.35E-06 mr1820 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251