Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315005214:

Variant ID: vg0315005214 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15005214
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TTCACATTATATATTTTGTACGCTTTGATCAATGAGAATCCATCCCTCTCGCTCTTGCTCCCACACTCTCAGCTGTCTTTTCAACACAAATTATTTCAAT[A/G]
ACTTCAATCAAAACCTTTTATGTACTTATGGACAGTTCGACTGACCATGCTCCTTTTATAAGATTTGCATATTTGGACTCTACTACTGTACTTCCTAAAG

Reverse complement sequence

CTTTAGGAAGTACAGTAGTAGAGTCCAAATATGCAAATCTTATAAAAGGAGCATGGTCAGTCGAACTGTCCATAAGTACATAAAAGGTTTTGATTGAAGT[T/C]
ATTGAAATAATTTGTGTTGAAAAGACAGCTGAGAGTGTGGGAGCAAGAGCGAGAGGGATGGATTCTCATTGATCAAAGCGTACAAAATATATAATGTGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	41.40%	0.30%	0.00%	NA
All Indica	2759	70.90%	28.90%	0.18%	0.00%	NA
All Japonica	1512	43.40%	56.20%	0.40%	0.00%	NA
Aus	269	1.10%	98.50%	0.37%	0.00%	NA
Indica I	595	46.20%	53.80%	0.00%	0.00%	NA
Indica II	465	51.20%	48.60%	0.22%	0.00%	NA
Indica III	913	89.40%	10.60%	0.00%	0.00%	NA
Indica Intermediate	786	79.90%	19.60%	0.51%	0.00%	NA
Temperate Japonica	767	17.70%	81.70%	0.52%	0.00%	NA
Tropical Japonica	504	64.10%	35.50%	0.40%	0.00%	NA
Japonica Intermediate	241	81.70%	18.30%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	6.20%	2.08%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315005214	A -> G	LOC_Os03g26220.1	upstream_gene_variant ; 651.0bp to feature; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N
vg0315005214	A -> G	LOC_Os03g26229.1	upstream_gene_variant ; 681.0bp to feature; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N
vg0315005214	A -> G	LOC_Os03g26210.1	downstream_gene_variant ; 3009.0bp to feature; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N
vg0315005214	A -> G	LOC_Os03g26240.1	downstream_gene_variant ; 3541.0bp to feature; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N
vg0315005214	A -> G	LOC_Os03g26210.3	downstream_gene_variant ; 3009.0bp to feature; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N
vg0315005214	A -> G	LOC_Os03g26210.2	downstream_gene_variant ; 3009.0bp to feature; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N
vg0315005214	A -> G	LOC_Os03g26220-LOC_Os03g26229	intergenic_region ; MODIFIER	silent_mutation	Average:44.445; most accessible tissue: Callus, score: 79.951	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315005214	NA	2.43E-08	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	8.43E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	2.05E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	4.15E-06	4.15E-06	mr1169	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	2.26E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	7.11E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	8.57E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	3.49E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	3.50E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	5.02E-08	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	5.78E-07	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	4.60E-06	mr1293	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	4.70E-06	mr1315	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	3.91E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	9.28E-07	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	5.80E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	4.17E-06	4.17E-06	mr1393	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	2.77E-06	2.77E-06	mr1412	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	2.11E-06	2.11E-06	mr1430	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	3.50E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	4.77E-06	mr1507	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	2.13E-08	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	4.07E-07	4.07E-07	mr1556	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	5.27E-08	mr1576	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	3.17E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	4.51E-07	4.42E-08	mr1683	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	8.96E-06	mr1685	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	6.59E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	2.13E-10	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	1.24E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	4.35E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	2.59E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	9.05E-07	mr1809	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	3.98E-06	mr1810	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	4.08E-06	4.08E-06	mr1820	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	1.74E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315005214	NA	9.55E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251