Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314935596:

Variant ID: vg0314935596 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14935596
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCCGGCGGGAGCGCGCGCGGTTGCCGGTGGAGAGAAGGCGAGGGGTCAGTCGATGGCAGCGGTGTTCAGGCGAAGTGATCGCGATGGCGAGATAGGCTG[G/A]
GTGCAGGCGGAGTGCGGTTACCGGTCGAGGTCAAGGGAAGGCGGAGGCACGGAGGGCAGGCGTGTTATCGATCGAGAGGTGAGGCGGAGGCGGAGCACGT

Reverse complement sequence

ACGTGCTCCGCCTCCGCCTCACCTCTCGATCGATAACACGCCTGCCCTCCGTGCCTCCGCCTTCCCTTGACCTCGACCGGTAACCGCACTCCGCCTGCAC[C/T]
CAGCCTATCTCGCCATCGCGATCACTTCGCCTGAACACCGCTGCCATCGACTGACCCCTCGCCTTCTCTCCACCGGCAACCGCGCGCGCTCCCGCCGGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	37.90%	1.04%	0.00%	NA
All Indica	2759	72.30%	27.20%	0.54%	0.00%	NA
All Japonica	1512	49.40%	48.70%	1.92%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	48.60%	50.40%	1.01%	0.00%	NA
Indica II	465	58.90%	40.90%	0.22%	0.00%	NA
Indica III	913	87.60%	12.30%	0.11%	0.00%	NA
Indica Intermediate	786	80.30%	18.80%	0.89%	0.00%	NA
Temperate Japonica	767	15.90%	80.60%	3.52%	0.00%	NA
Tropical Japonica	504	83.30%	16.30%	0.40%	0.00%	NA
Japonica Intermediate	241	85.10%	14.90%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	60.00%	34.40%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314935596	G -> A	LOC_Os03g26060.1	stop_gained ; p.Trp142*; HIGH	stop_gained	Average:91.11; most accessible tissue: Minghui63 root, score: 94.839	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0314935596	G	A	-0.2	-0.11	-0.1	-0.11	-0.2	-0.22

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314935596	NA	2.79E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	4.72E-06	4.72E-06	mr1294_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	NA	2.51E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	1.40E-06	1.40E-06	mr1604_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	NA	9.84E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	2.74E-06	2.74E-06	mr1777_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	6.14E-06	6.14E-06	mr1824_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	NA	7.49E-06	mr1836_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	8.76E-06	8.75E-06	mr1840_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314935596	NA	3.23E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251