Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314706879:

Variant ID: vg0314706879 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 14706879
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAAAATTTGGCAGCAAACTAAATGTAGCCACTTTTTTGGCAACGTTACCAAATTTTGGTAAGGTTGAAAATGGCATCAAAGTGAACAGGCCCCACATT[C/T]
CAGATTTGAACATCACGATTTCAGATTACACAATATTGCAGATCTTATTTTCGCAAGGAATCAGAGAAACAACCACAAGTTTTTTAACAAATCAATCACT

Reverse complement sequence

AGTGATTGATTTGTTAAAAAACTTGTGGTTGTTTCTCTGATTCCTTGCGAAAATAAGATCTGCAATATTGTGTAATCTGAAATCGTGATGTTCAAATCTG[G/A]
AATGTGGGGCCTGTTCACTTTGATGCCATTTTCAACCTTACCAAAATTTGGTAACGTTGCCAAAAAAGTGGCTACATTTAGTTTGCTGCCAAATTTTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 5.70% 2.69% 21.86% NA
All Indica  2759 67.70% 0.00% 1.78% 30.45% NA
All Japonica  1512 76.80% 17.50% 4.70% 0.99% NA
Aus  269 40.10% 0.00% 1.86% 57.99% NA
Indica I  595 64.40% 0.00% 1.01% 34.62% NA
Indica II  465 33.50% 0.00% 4.52% 61.94% NA
Indica III  913 88.80% 0.00% 0.66% 10.51% NA
Indica Intermediate  786 66.00% 0.10% 2.04% 31.81% NA
Temperate Japonica  767 59.30% 31.90% 8.60% 0.13% NA
Tropical Japonica  504 96.20% 1.40% 0.20% 2.18% NA
Japonica Intermediate  241 91.70% 5.40% 1.66% 1.24% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 74.40% 5.60% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0314706879 C -> T LOC_Os03g25690.1 upstream_gene_variant ; 4902.0bp to feature; MODIFIER silent_mutation Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0314706879 C -> T LOC_Os03g25700.1 upstream_gene_variant ; 1683.0bp to feature; MODIFIER silent_mutation Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0314706879 C -> T LOC_Os03g25690-LOC_Os03g25700 intergenic_region ; MODIFIER silent_mutation Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg0314706879 C -> DEL N N silent_mutation Average:28.344; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0314706879 8.61E-07 NA mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 1.31E-07 1.25E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 3.94E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 2.15E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 1.92E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 7.18E-06 NA mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 5.81E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 9.89E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 6.52E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 2.73E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 1.19E-07 NA mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 1.03E-06 NA mr1382 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 4.41E-08 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 1.35E-06 2.35E-09 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 2.54E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 6.37E-07 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 7.49E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 1.47E-06 NA mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 6.02E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 2.35E-08 7.77E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 7.50E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 6.72E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 1.37E-12 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 9.75E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 4.75E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 2.12E-06 NA mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 1.53E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 3.65E-06 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 1.64E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 2.99E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 2.80E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 5.56E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 9.88E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 1.25E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 6.27E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 6.99E-07 3.94E-08 mr1955 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 8.55E-06 8.55E-06 mr1955 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 6.20E-10 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 3.35E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 7.52E-06 NA mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 6.89E-06 6.89E-06 mr1992 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 1.39E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314706879 NA 5.36E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251