Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314581119:

Variant ID: vg0314581119 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14581119
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGGGTGACCCTCTCTAGCGGGAGGCTGTGAGGCCCCCCTTTGAGAGTTCGGCCGGGGGCAGCGGGTGAGATTCGAGGATTTGGTGAGCGAAACTGTGT[G/A]
TGATCTTGATCTCGGAGGCTCCTCCAAGACGATGAGACAAAAGAGGTTTATATAGGTTCGGGCCGCTATGAAGCGTAATACCCTACTCCTGTGTGTATGA

Reverse complement sequence

TCATACACACAGGAGTAGGGTATTACGCTTCATAGCGGCCCGAACCTATATAAACCTCTTTTGTCTCATCGTCTTGGAGGAGCCTCCGAGATCAAGATCA[C/T]
ACACAGTTTCGCTCACCAAATCCTCGAATCTCACCCGCTGCCCCCGGCCGAACTCTCAAAGGGGGGCCTCACAGCCTCCCGCTAGAGAGGGTCACCCCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	23.70%	0.40%	0.00%	NA
All Indica	2759	69.10%	30.50%	0.40%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	8.90%	88.50%	2.60%	0.00%	NA
Indica I	595	51.40%	48.10%	0.50%	0.00%	NA
Indica II	465	59.40%	40.40%	0.22%	0.00%	NA
Indica III	913	81.20%	18.50%	0.33%	0.00%	NA
Indica Intermediate	786	74.20%	25.30%	0.51%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314581119	G -> A	LOC_Os03g25540.1	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:46.137; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0314581119	G -> A	LOC_Os03g25530.1	downstream_gene_variant ; 1873.0bp to feature; MODIFIER	silent_mutation	Average:46.137; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0314581119	G -> A	LOC_Os03g25530-LOC_Os03g25540	intergenic_region ; MODIFIER	silent_mutation	Average:46.137; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314581119	NA	3.98E-09	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119	1.75E-08	NA	mr1542_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119	8.31E-09	6.30E-13	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119	NA	1.05E-15	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314581119	2.93E-06	2.99E-08	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251