Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314576905:

Variant ID: vg0314576905 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14576905
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTCCACGCCCGCTACGAAACCGCAGGAGGCGCACCCGCGGGCCCTCACCCCAGCCAAGAAGAAGCAAGAGACCAAGCCTGACCCCGCTAGGAAGCGA[C/T]
GGCGGTGGCGCGGCTTCATCTTCATTCGTGTGTCGCCTCACTAGTGGTCACTAGAATGGATACTATCATCTCAATCGGGCGGCAACTCCCATCTCAATCG

Reverse complement sequence

CGATTGAGATGGGAGTTGCCGCCCGATTGAGATGATAGTATCCATTCTAGTGACCACTAGTGAGGCGACACACGAATGAAGATGAAGCCGCGCCACCGCC[G/A]
TCGCTTCCTAGCGGGGTCAGGCTTGGTCTCTTGCTTCTTCTTGGCTGGGGTGAGGGCCCGCGGGTGCGCCTCCTGCGGTTTCGTAGCGGGCGTGGAGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	28.10%	0.13%	0.55%	NA
All Indica	2759	58.20%	40.70%	0.14%	0.91%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	37.50%	62.50%	0.00%	0.00%	NA
Indica I	595	53.30%	45.40%	0.34%	1.01%	NA
Indica II	465	26.50%	72.50%	0.00%	1.08%	NA
Indica III	913	80.30%	19.20%	0.00%	0.55%	NA
Indica Intermediate	786	55.20%	43.40%	0.25%	1.15%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	68.90%	27.80%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314576905	C -> T	LOC_Os03g25510.1	upstream_gene_variant ; 2130.0bp to feature; MODIFIER	silent_mutation	Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0314576905	C -> T	LOC_Os03g25530.1	upstream_gene_variant ; 1634.0bp to feature; MODIFIER	silent_mutation	Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0314576905	C -> T	LOC_Os03g25510-LOC_Os03g25530	intergenic_region ; MODIFIER	silent_mutation	Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0314576905	C -> DEL	N	N	silent_mutation	Average:65.803; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314576905	1.26E-50	2.68E-119	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	6.20E-38	6.14E-61	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	NA	4.03E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	NA	1.02E-09	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	2.85E-59	5.75E-142	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	1.31E-49	1.58E-76	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	1.37E-20	4.45E-35	mr1587_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	1.00E-13	4.05E-18	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314576905	NA	1.92E-10	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251