Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314568077:

Variant ID: vg0314568077 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 14568077
Reference Allele: T	Alternative Allele: A,TCTCA,TCA,TCACA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTGTTGCTGTTCTTGCGTTTGGCTCTTTCTTTGTTGGAAGCATTTGCACCAAGGGAATTTTGATGCTACTTGTCAATCTCTCTCCTCTCTCTCTCTCTC[T/A,TCTCA,TCA,TCACA]
CACACACAGACACACACAATCAATCAAGTAGTATCTATCAGTGCTAAATACTACTCCCACGTCTCATTATAAATGCAACTATAAGTTTCCGTCCAACGTT

Reverse complement sequence

AACGTTGGACGGAAACTTATAGTTGCATTTATAATGAGACGTGGGAGTAGTATTTAGCACTGATAGATACTACTTGATTGATTGTGTGTGTCTGTGTGTG[A/T,TGAGA,TGA,TGTGA]
GAGAGAGAGAGAGAGGAGAGAGATTGACAAGTAGCATCAAAATTCCCTTGGTGCAAATGCTTCCAACAAAGAAAGAGCCAAACGCAAGAACAGCAACAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	12.70%	2.58%	0.51%	TCTCA: 12.25%; TCA: 0.21%; TCACA: 0.06%
All Indica	2759	55.70%	21.10%	4.17%	0.87%	TCTCA: 17.83%; TCA: 0.29%; TCACA: 0.07%
All Japonica	1512	99.50%	0.20%	0.07%	0.00%	TCTCA: 0.26%
Aus	269	71.00%	1.50%	0.37%	0.00%	TCTCA: 26.02%; TCA: 0.74%; TCACA: 0.37%
Indica I	595	50.80%	9.60%	3.36%	0.50%	TCTCA: 35.46%; TCA: 0.34%
Indica II	465	22.40%	33.80%	4.09%	1.94%	TCTCA: 37.42%; TCA: 0.43%
Indica III	913	78.50%	16.10%	3.29%	0.44%	TCTCA: 1.64%
Indica Intermediate	786	52.50%	28.10%	5.85%	1.02%	TCTCA: 11.70%; TCA: 0.51%; TCACA: 0.25%
Temperate Japonica	767	99.50%	0.30%	0.13%	0.00%	TCTCA: 0.13%
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	0.00%	TCTCA: 1.24%
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	71.10%	10.00%	4.44%	0.00%	TCTCA: 14.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314568077	T -> TCA	LOC_Os03g25500.1	intron_variant ; MODIFIER	silent_mutation	Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246	N	N	N	N
vg0314568077	T -> TCACA	LOC_Os03g25500.1	intron_variant ; MODIFIER	silent_mutation	Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246	N	N	N	N
vg0314568077	T -> DEL	N	N	silent_mutation	Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246	N	N	N	N
vg0314568077	T -> A	LOC_Os03g25500.1	intron_variant ; MODIFIER	silent_mutation	Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246	N	N	N	N
vg0314568077	T -> TCTCA	LOC_Os03g25500.1	intron_variant ; MODIFIER	silent_mutation	Average:79.677; most accessible tissue: Minghui63 flower, score: 94.246	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0314568077	T	A	-0.03	-0.02	-0.01	0.0	0.02	0.03
vg0314568077	T	TCA	0.08	0.25	0.19	-0.2	-0.09	-0.08
vg0314568077	T	TCACA	0.2	0.45	0.39	0.22	0.2	0.02
vg0314568077	T	TCTCA	0.25	0.46	0.39	0.23	0.24	0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314568077	2.02E-18	1.72E-59	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	8.74E-21	1.48E-38	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	3.08E-06	2.66E-11	mr1902	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	4.16E-22	2.91E-66	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	1.03E-27	1.29E-45	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	3.64E-06	NA	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	1.22E-06	3.68E-11	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	NA	3.46E-12	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314568077	NA	5.72E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251