Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314521197:

Variant ID: vg0314521197 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14521197
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTGTTGAGTTGATGACATATGGAGCCATAATGGATGAGAAGGAATCTTGCCACAAGTGTGACTATGAACGAAACAATAGACTAACTTGGTAAAACTTG[C/T]
CTAACATGAGGTGCGGCAACCTCTGGAGTAAACCAAACAACCCCTAAGGTTTTTTTTTCTTTTTGAGGATGAAGCAGTTAAGTTTAGACGTGGTTATGTA

Reverse complement sequence

TACATAACCACGTCTAAACTTAACTGCTTCATCCTCAAAAAGAAAAAAAAACCTTAGGGGTTGTTTGGTTTACTCCAGAGGTTGCCGCACCTCATGTTAG[G/A]
CAAGTTTTACCAAGTTAGTCTATTGTTTCGTTCATAGTCACACTTGTGGCAAGATTCCTTCTCATCCATTATGGCTCCATATGTCATCAACTCAACAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	13.10%	0.06%	0.40%	NA
All Indica	2759	80.60%	19.20%	0.11%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.07%	NA
Aus	269	73.20%	26.40%	0.00%	0.37%	NA
Indica I	595	60.70%	39.20%	0.17%	0.00%	NA
Indica II	465	60.40%	39.60%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	87.30%	12.50%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	82.30%	1.00%	0.00%	16.67%	NA
Intermediate	90	83.30%	15.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314521197	C -> T	LOC_Os03g25390.2	upstream_gene_variant ; 2649.0bp to feature; MODIFIER	silent_mutation	Average:67.151; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0314521197	C -> T	LOC_Os03g25400.1	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:67.151; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0314521197	C -> T	LOC_Os03g25390.1	upstream_gene_variant ; 2649.0bp to feature; MODIFIER	silent_mutation	Average:67.151; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0314521197	C -> T	LOC_Os03g25390.3	upstream_gene_variant ; 2649.0bp to feature; MODIFIER	silent_mutation	Average:67.151; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0314521197	C -> T	LOC_Os03g25394.1	intron_variant ; MODIFIER	silent_mutation	Average:67.151; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N
vg0314521197	C -> DEL	N	N	silent_mutation	Average:67.151; most accessible tissue: Zhenshan97 panicle, score: 89.143	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0314521197	C	T	-0.07	-0.04	-0.05	-0.06	-0.09	-0.11

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314521197	NA	2.79E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314521197	3.20E-17	1.01E-37	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314521197	2.90E-14	2.37E-19	mr1542	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314521197	2.27E-19	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314521197	1.29E-17	6.71E-22	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314521197	8.19E-08	NA	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314521197	NA	6.03E-06	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251