Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314498825:

Variant ID: vg0314498825 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14498825
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCTTCACCGGAGATCGAAAGCCGACGCAGCCCCGCGTCAGGTGCCAAATTCTGCCGGATGATAAATAAAAACCTCAGTAAAGAGGGTGGCGATGCACC[G/A]
AGAGTAGTTGTATTGATCGATATATTGATAGATTACAATGACCCCGGGTGTACATATTTATACCCATAGGGAGATACTAGTCCTTATCGGACAAGAAAGA

Reverse complement sequence

TCTTTCTTGTCCGATAAGGACTAGTATCTCCCTATGGGTATAAATATGTACACCCGGGGTCATTGTAATCTATCAATATATCGATCAATACAACTACTCT[C/T]
GGTGCATCGCCACCCTCTTTACTGAGGTTTTTATTTATCATCCGGCAGAATTTGGCACCTGACGCGGGGCTGCGTCGGCTTTCGATCTCCGGTGAAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	24.30%	2.35%	2.88%	NA
All Indica	2759	50.60%	40.70%	3.88%	4.75%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.07%	NA
Aus	269	98.90%	0.00%	0.74%	0.37%	NA
Indica I	595	56.10%	37.30%	6.39%	0.17%	NA
Indica II	465	58.50%	24.70%	5.38%	11.40%	NA
Indica III	913	44.60%	52.50%	1.20%	1.75%	NA
Indica Intermediate	786	48.90%	39.20%	4.20%	7.76%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	5.20%	0.00%	1.04%	NA
Intermediate	90	80.00%	16.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314498825	G -> A	LOC_Os03g25364.1	upstream_gene_variant ; 2492.0bp to feature; MODIFIER	silent_mutation	Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0314498825	G -> A	LOC_Os03g25360.1	downstream_gene_variant ; 2462.0bp to feature; MODIFIER	silent_mutation	Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0314498825	G -> A	LOC_Os03g25360-LOC_Os03g25364	intergenic_region ; MODIFIER	silent_mutation	Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0314498825	G -> DEL	N	N	silent_mutation	Average:37.931; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314498825	4.64E-22	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825	2.86E-19	1.87E-28	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825	NA	1.50E-06	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825	2.20E-27	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825	2.77E-28	1.75E-35	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825	4.36E-11	NA	mr1587_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314498825	3.59E-10	5.81E-15	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251