Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0314430615:

Variant ID: vg0314430615 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 14430615
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGTAGAAACAACCTCTTCATATATAGTCCCTAATATAACATTACTCCATAAAAATAAGGACGTAACGCATAACTAGATACCGGTAGAAACTGTCTCTT[C/T]
ATATATAGTCCCTAATAGGATGTTACTCCATAAAAATAAGGATGAAATGCATACTTGGATACCGATAGAAACAATTGCTTTATATATATAGTCGCTAATA

Reverse complement sequence

TATTAGCGACTATATATATAAAGCAATTGTTTCTATCGGTATCCAAGTATGCATTTCATCCTTATTTTTATGGAGTAACATCCTATTAGGGACTATATAT[G/A]
AAGAGACAGTTTCTACCGGTATCTAGTTATGCGTTACGTCCTTATTTTTATGGAGTAATGTTATATTAGGGACTATATATGAAGAGGTTGTTTCTACCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	4.70%	4.93%	32.12%	NA
All Indica	2759	75.30%	6.50%	6.74%	11.49%	NA
All Japonica	1512	34.50%	0.10%	0.40%	65.08%	NA
Aus	269	36.40%	13.40%	13.01%	37.17%	NA
Indica I	595	55.80%	9.40%	8.24%	26.55%	NA
Indica II	465	59.10%	14.80%	8.60%	17.42%	NA
Indica III	913	91.70%	1.00%	5.48%	1.86%	NA
Indica Intermediate	786	80.50%	5.70%	5.98%	7.76%	NA
Temperate Japonica	767	61.80%	0.00%	0.52%	37.68%	NA
Tropical Japonica	504	4.00%	0.00%	0.00%	96.03%	NA
Japonica Intermediate	241	11.20%	0.40%	0.83%	87.55%	NA
VI/Aromatic	96	17.70%	0.00%	2.08%	80.21%	NA
Intermediate	90	43.30%	7.80%	4.44%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0314430615	C -> T	LOC_Os03g25270.1	upstream_gene_variant ; 1156.0bp to feature; MODIFIER	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0314430615	C -> T	LOC_Os03g25270.2	upstream_gene_variant ; 1014.0bp to feature; MODIFIER	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0314430615	C -> T	LOC_Os03g25270.3	upstream_gene_variant ; 1251.0bp to feature; MODIFIER	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0314430615	C -> T	LOC_Os03g25270.4	upstream_gene_variant ; 1257.0bp to feature; MODIFIER	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0314430615	C -> T	LOC_Os03g25260.1	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0314430615	C -> T	LOC_Os03g25260-LOC_Os03g25270	intergenic_region ; MODIFIER	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0314430615	C -> DEL	N	N	silent_mutation	Average:36.694; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0314430615	5.85E-07	5.83E-07	mr1250	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615	3.05E-07	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615	NA	1.29E-09	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615	6.15E-07	NA	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0314430615	NA	7.51E-12	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251